Table 2

Oligonucleotide sequences used to amplify C-prM gene junction of dengue virus.

Sr. No.

Primer Name

5'-3' Sequence

Size of amplified product in base pairs


1

D1-D

TCAATATGCTGAAACGCGWGAGAAACCG

511 bp

2

D2-D

TTGCACCARCARTCWATGTCTTCWGGYTC

3

TS1-F

AGGACCCATGAAATTGGTGA

411 bp

4

TS1-R

ACGTCATCTGGTTCCGTCTC

5

TS2-F

AGAGAAACCGCGTGTCAACT

403 bp

6

TS2-R

ATGGCCATGAGGGTACACAT

7

TS3-F

ACCGTGTGTCAACTGGATCA

453 bp

8

TS3-R

CAGTAATGAGGGGGCATTTG

9

TS4-F

CCTCAAGGGTTGGTGAAGAG

401 bp


10

TS4-R

CCTCACACATTTCACCCAAGT


Fatima et al. BMC Microbiology 2011 11:200   doi:10.1186/1471-2180-11-200

Open Data