Table 2

Description of 12 VNTR loci analyzing with 202 H.pylori clinical isolates

Locus

Forward and Reverse primer (F/R)

Annealing temperature (°C)

Expected product length in 26695 (bp)

Product size range

Allele size range(unites)

Total number

of alleles

Nei's diversity index


VNTR-180

F:TAAAGTGAAAGCGTTACAAAAAGAC R:CTTCAGGGTAGGAATACAGCAGAGT

53

185

165-225

1-4

4

55. 7

VNTR-263

F:TTGAATTGCAAGCTAATGAGTC R:AGAAGTGTTGATGCTAGAAGAG

52

352

310-366

1-5

5

63. 0

VNTR-614

F:ATTGATTATGATTTTCTTGGCAATTTTG R:GCTTATGAATGTGTGTTTTGCTGATGAC

54

758

334-864

1-7, 11

9

80. 7

VNTR-557

F:ATGGAAGTTTTTGATTTGATTG R:GGTGTAATGGGTGTTGATGGTC

50

152

152-202

1-3,

3

12. 3

VNTR-607

F:GAATTGATTATGATTTTCTTGGCAAT R: GCTGAAAACGCTAGGGATAGAGC

52

668

233-673

1, 2, 5-21, 23

20

92. 8

VNTR-1801

F:GCCGTATTTTAGGATAAAGCAAAG R:CGCGTTTTATAGCGCTTCTTATT

52

280

280-604

1-5, 12

5

57. 3

VNTR-2181

F:TTATGGAAAATATCATACAACCCCCTAT R:ATTTAGAAAAATTACCCCTTTCATCAAG

52

378

378-426

1-3, 5

4

20. 9

VNTR-2457

F:TAGAAGATTGCTTGAAAAGCCCTTT R:GCTCTATGATTTTAAAACGCTCCGT

52

650

650-812

1-4

4

73. 6

VNTR-2576

F:GATTTTTGATARGCTTTGCGATAG R:TAAAACGATTTTAGAAAACGACAC

51

371

182-371

1-7, 10

8

46. 2

VNTR-5062

F:AAGCTCGCCCTCATCGCC R:TAAAAAATATTAAATAATCAATT

50

307

223-259

1-4

4

40. 9

VNTR-5282

F:CCTTAAGCTCTTTAGGGGCTGG R:GAGAGTTCTAGGGGCGTGGC

56

335

335-371

1-4

4

36. 2

VNTR-5581

F:CGTTCACTCTGAGCCAGGATC R:GCTCTTTCTGTTTTGTTGTTGTAAT

52

202

190-218

1-3

3

34. 3


Guo et al. BMC Microbiology 2011 11:197   doi:10.1186/1471-2180-11-197

Open Data