Table 2

Oligonucleotides used in this study

Primer

Oligonucleotide Sequence 5'-3'

Targeta

Product size

Reference


Rp-F1

ATGATCTAGCTTGCTAGATTGAT

16S rRNA gene

210 bp

[32]

Rp-R1

ACTGATCGTCGCCTTGGTG

16S rRNA gene

[32]

R38R1

CACACCTAATATTAGTAAGTGCG

16S rRNA gene

403 bp

[33]

16SF

TTGTACACACCGCCCGTCA

16S-23S Spacer Region

860 bp

[34]

23SR

GGTACCTTAGATGTTTCAGTTC

16S-23S Spacer Region

[34]

Ral_fliCF

CCTCAGCCTCAATACCAACATC

fliC gene

725 bp

[35]

Ral_fliCR

CATGTTCGACGTTTCMGAWGC

fliC gene

[35]

M13

TTATGTAAAACGACGGCCAGT

RAPD Primer

N\A

[36]

P3

AGACGTCCAC

RAPD Primer

N\A

[37]

P15

AATGGCGCAG

RAPD Primer

N\A

[37]

OPA03U

AGTCAGCCAC

RAPD Primer

N\A

[38]

BOX-A1R

CTACGGCAAGGCGACGCTGACG

BOX Primer

N\A

[39]


Ryan et al. BMC Microbiology 2011 11:194   doi:10.1186/1471-2180-11-194

Open Data