Table 2

Oligonucleotide primers used for the construction of chimeras and mutants of PCV2

Chimera/mutant

Primer

Sequence


rCL-YJ-1

A-F

5'-AGATTTAATATTAACGACTTTGTTC-3'

A-R

5'-GTTGAAGATGCCATTTTTCCT-3'

B-F

5'-AGGAAAAATGGCATCTTCAACGCCCGCCTCTCCCGCACCTTCGGATATACTATCAAGCGAG

CCACAGTCAAAACGCCCTCCTGGGCGGTGGACATGATGAGATTTAATATTAACGACTTT-3'

B-R

5'-AAAGTCGTTAATATTAAATCTCATCATGTCCACCGCCCAGGAGGGCGTTTTGACTGTGGCTC

GCTTGATAGTATATCCGAAGGTGCGGGAGAGGCGGGCGTTGAAGATGCCATTTTTCCT-3'


rCL-YJ-2

C-F

5'-TACTACAGAATAAGGAAGGTTAAGG-3'

C-R

5'-AAAGTCGTTAATATTAAATCTAATC-3'

D-F

5'-ATTAGATTTAATATTAACGACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCGCTCTGTGCC

CTTTGAATACTACAGAATAAGGAAGGTTAAG-3'

D-R

5'-CTTAACCTTCCTTATTCTGTAGTATTCAAAGGGCACAGAGCGGGGGTTTGAGCCCCCTCCT

GGGGGAAGAAAGTCGTTAATATTAAATCTAAT- 3'


rCL-YJ-3

E-F

5'-TCCTACCACTCCCGGTACTTTA-3'

E-R

5'-GGAGCAGGGCCAGAATTCAA-3'

F-F

5'-TAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAGTGGGCTCCAG

TGCTGCTATTCTAGATGATAACTTTGTAACAAAGGCCACAGCCCTCACCTATGACCCCTATGTA

AACTACTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCACTCCCGCTACTTTACCC-3'

F-R

5'-GGGTAAAGTACCGGGAGTGGTAGGAGAAGGGCTGGGTTATGGTATGGCGGGAGGAGTAGT

TTACATAGGGGTCATAGGTGAGGGCTGTGGCCTTTGTTACAAAGTTATCATCTAGAATAGCAGC

ACTGGAGC CCACTCCCCTGTCACCCTGGGTGATCGGGGAGCAGGGCCAGAATTCAACCTTA-3'


rCL-YJ-4

G-F

5'-AATATCCGGGTAACTATGTATGT-3'

G-R

5'-GGTTTGTAGTCTCAGCCAAAG-3'

H-F

5'-CTTTGGCTGAGACTACAAACCGCTGGAAATGTAGACCACGTAGGCCTCGGCACTGCGTTC

GAAAACAGTATATACGACCAGGAATACAATATCCGGGTAACTATGTAT-3'

H-R

5'-ATACATAGTTACCCGGATATTGTATTCCTGGTCGTATATACTGTTTTCGAACGCAGTGCCGA

GGCCTACGTGGTCTACATTTCCAGCGGTTTGTAGTCTCAGCCAAAG-3'


rCL-YJ-5

I-F

5'-GACCCCCCACTTAACCTTAATGAATAATAAAAAC-3'

I-R

5'-GTTTTTATTATTCATTAAGGTTAAGTGGGGGGTC-3'


rCL-YJ-1-51

J-F

5'-CACCCGCCTCTCCCGCACCTTCGGATA-3'

J-R

5'-TATCCGAAGGTGCGGGAGAGGCGGGTG-3'


rCL-YJ-1-57

K-F

5'-ACCTTCGGATATACTATCAAGGCTACCAC-3'

K-R

5'-GTGGTAGCCTTGATAGTATATCCGAAGGT-3'


rCL-YJ-1-59

L-F

5'-GGATATACTGTCAAGCGAACCACAGTCAGAAC-3'

L-R

5'-GTTCTGACTGTGGTTCGCTTGACAGTATATCC-3'


rCL-YJ-1-63

M-F

5'-GCTACCACAGTCAAAACGCCCTCCTGG-3'

M-R

5'-CCAGGAGGGCGTTTTGACTGTGGTAGC-3'


rLG-YJ-1-59

N-F

5'-GGATATACTGTCAAGCGAACCACAGTCAGAAC-3'

N-R

5'-GTTCTGACTGTGGTTCGCTTGACAGTATATCC-3'


rJF2-YJ-1-59

O-F

5'-GGATATACTGTCAAGCGAACCACAGTCAGAAC-3'

O-R

5'-GTTCTGACTGTGGTTCGCTTGACAGTATATCC-3'


rYJ-CL-1-59

P-F

5'-CGGATATACTATCAAGGCTGCCACAGTCAAAAC-3'

P-R

5'-GTTTTGACTGTGGCAGCCTTGATAGTATATCCG-3'


complete genome of PCV2

Q-F

5'-GTCGACGGAGGAAGGGGGCCAGTT-3'

Q-R

5'-GTCGACTGTTCTGTAGCATTCTTCCA-3'


Huang et al. BMC Microbiology 2011 11:188   doi:10.1186/1471-2180-11-188

Open Data