Table 2

Primers used in this work

Name

Sequence (5'-3')

Reference


711d

CATATGATGGGACCAAACACCTAGGG

[19]

711u

CACAAGACTGCGTTGCCGACAGA

[19]

RB51

CCCCGGAAGATATGCTTCGATCC

[12]

IS711out

CAAGTTGAAACGCTATCGTCGC

This work

P5

CGGCCCCGGT

[20]

BruAb1_0736F

TTGGTTTCCTTGCGACAGAT

This work

BruAb1_0737R

AACCTTGCCTTTAGTTGCTCA

This work

BruAb2_0461F

ATCAGGCTTTGCTGGCAATC

This work

BruAb2_0461R

TCGTTTGCCATCTTGTTCAG

This work

marR-F1

GACGTGGTGGAGGAAACCTA

This work

marR-R2

ACTCGGCCAAACCTGATAA

This work

marR-F3

TTATCAGGTTTTGGCCGAGTCACATTGGAGTTGACCATCG

This work

marR-R4

CGCTTCGTGGTACGCTATTT

This work


Mancilla et al. BMC Microbiology 2011 11:176   doi:10.1186/1471-2180-11-176

Open Data