Table 5

Sequences of the primers used for the construction of a full-length cDNA clone and mutants of FMDV Asia1/JSp1c8

Name

Nucleotide Sequence (5'→3')

Nucleotide Position (nt)


E1

CA

    GGATCC
TAATACGACTCACTATAGGGTTGAAAAGG GGCGCTAGGGTC

1-21

E1'

TAAAACTTAGGGGGGGGGGGGGGGGGGGGTGAAAG

361-390

E2

TTTCACCCCCCCCCCCCCCCCCCCCTAAGTTTTAC

362-391

E2'

CC

    TCTAGA
CCTGGAAAGACCAGGC

677-700

E3

AGG

    TCTAGA
GGGGTGACATTTTGT

690-713

E3'

GT

    CTGCAG
CAGAAAGGTAAGGGAT

3078-3101

E4

CTG

    CTGCAG
ACTATGCTTACACTG

3090-3113

E4'

AAA

    GAATTC
AATTGCTGCCTCATG

5414-5437

E5

AATT

    GAATTC
TTTGAGGGAATGGTGCAC

5425-5452

E5'

TT

    GCGGCCGC
TTT(38)

3'end

P1

ACAAGGAAAGATGGA

    GC
TCACACTTCACAAC

1168-1198

P1'

GTTGTGAAGTGTGA

    GC
TCCATCTTTCCTTGT

1168-1198

TR1

ACTGCATTCATTCTGAGTGGGA

2960-2984

TR1'

GGCAAGATCAC

    C
ACGCCGCGAGGA

3679-3703(D→G)

TR2

TCCTCGCGGCGT

    G
GTGATCTTGCC

3679-3703(D→G)

TR2'

5'-GAAGAAACTCGAGGCGACTTTGAC-3'

4342-4366

TR3

TCCTCGCGGCGT

    AG
TGATCTTGCC

3679-3703(D→S)

TR3'

GGCAAGATCA

    CT
ACGCCGCGAGGA

3679-3703(D→S)


Nucleotide positions of primers used for cloning are shown: numbering according to Asia1/JS/CHA/05 (Genbank Accession: EF149009). T7 promoter sequences are marked with italic type, the restriction sites are highlighted by underlining, silent mutations within the viral sequence are underlined and amino acid changes are shown in brackets.

Li et al. BMC Microbiology 2011 11:154   doi:10.1186/1471-2180-11-154

Open Data