Table 1

Primers and probes designed for the GeneDisc® assay

Target sequence

Forward primer, reverse primer and probe sequences (5'-3')

GenBank accession number

Location within sequence


DT104

GGACCTGGCTGAGTTTATTTCG

1370 - 1391

16S-23S

GCATCGGCTGTGAGACCAA*

AF275268

1438 - 1420

spacera

FAM-TGGTTTCTGAAAGCGGAGCTAATGCG-BHQ

1393 - 1418


TCTGCTGAGCGACAACAGATTT

1498146 - 1498167

ssaQb

TGGCACCAGCCTGAATATACAG*

AE006468

1498213 - 1498192

ROX-TCCTGCCCCTCCTGTGGTAGT -BHQ

1498169 - 1498189


AAGAGGCCGCGATCTGTTTA*

3964669 - 3964650

mgtCc

CGAATTTCTTTATAGCCCTGTTCCT

AE006468

3964600 - 3964624

ROX-AAGGGTTAGGTTCGGTCCCCG-BHQ *

3964648 - 3964628


CGGCGGACTTACTTTTTGAAA

4482051 - 4482071

spi4_Dd

TGGTCACGGTATTTGGGTAATATTT*

AE006468

4482132 - 4482108

ROX-CCAAAAGTAAGGACTATGCTGGCCG-BHQ

4482077 - 4482101


CTTATGAGGGAAAGGGCG*

1179300 - 1179283

sopBe

ATGCACACTCACCGTGG

AE006468

1179215 - 1179231

ROX-TTGGGATACCAAGAATATTCATCACGCC-BHQ*

1179275 - 1179248


AATGAACTACGAAGTGGGCG*

24307 - 24288

spvCf

TCAAACGATAAAACGGTTCCTC

FN432031

24232 - 24253

FAM-ATGGTGGCGAAATGCAGAGACAGGC -BHQ*

24285 - 24261


GGATTTTCTCCAGCTTCTGT

132 - 151

Left junction of SGI1g

CTAACCATAAGAGAACTTCC*

AF261825

263 - 244

FAM-TAAATCTCCTAAATTAAATTAAAACGAAGTAAAACC -BHQ

161 - 197


TGGGCAGCAGCGAAGTC*

27686 - 27670

intI1h

TGCGTGGAGACCGAAACC

AF261825

27617 - 27634

FAM-AGGCATTTCTGTCCTGGCTGGCG-BHQ*

27668 - 27646


CTGGATCTCAACAGCGG

270 - 286

blaTEMi

CAACACGGGATAATACCGC*

AJ634602

378 - 360

FAM- AGATCCTTGAGAGTTTTCGCCCCG-BHQ

289 - 312


TCCTGACCCTGCGCTCTATC

29611 - 29630

sul1j

TGCGCTGAGTGCATAACCA*

AF261825

29679 - 29661

ROX-ATTGCTGAGGCGGACTGCAGGC -BHQ

29636 - 29657


FAM = 6-carboxylfluorescein; ROX = carboxy-X-rhodamine; BHQ = Black Hole Quencher. * complementary strand; a:marker of the phage type DT104 located in the 16S-to-23S spacer region of bacterial rRNA genes [4]; b: gene encoding SsaQ; c: gene encoding MgtC; d: gene encoding Spi4_D; e: gene encoding SopB; f: gene encoding SpvC; g: marker of the SGI1 left junction which is composed of the end of the thdF gene and the intergenic sequence between thdF and int genes [8]; h: marker targeting the gene encoding the integrase of the class 1 integron inside SGI1; i: gene encoding beta-lactam resistance; j:gene encoding sulphonamide resistance.

Bugarel et al. BMC Microbiology 2011 11:151   doi:10.1186/1471-2180-11-151

Open Data