Table 10

Primers and probes for real-time PCR detection of virulence genes developed for this study

Target genea

Forward primer, reverse primer and probe sequences (5'-3')

Location within sequences

Gene Bank accession no.


nleG6-2 (Z2150)

ATATGCTCTCTATATGATAAGGATG

1928877-1928901

AE005174

AAAGTGACATTCGTCTTTTCTCATA

1928996-1928872

[6FAM]CGTTAGTGCAACTTGTTGAAACTGGTGGAA[BHQ1]

1928902-1928931

nleG5-2 (Z2151)

AGACTATTCGTGGAGAAGCTCAAG

1929199-1929222

AE005174

TATTGAAGGCCAATCTGGATG

1929337-1929317

[6FAM]TGGATATTTTATGGGAAGTCTTAACCAGGATGG[BHQ1]

1929269-1929301

espK

ATTGTAACTGATGTTATTTCGTTTGG

1673295-1673320

AE005174

GRCATCAAAAGCGAAATCACACC

1673419-1673397

[6FAM]CAGATACTCAATATCACAATCTTTGATATATAAACGACC[BHQ1]

1673330-1673368

bfpA

CCAGTCTGCGTCTGATTCCA

2756-2775

FM180569

CGTTGCGCTCATTACTTCTGAA

2816-2795

TAAGTCGCAGAATGC-MGB

2777-2791


a) Z2150 and Z2151 derive from OI-57 [24]

Bugarel et al. BMC Microbiology 2011 11:142   doi:10.1186/1471-2180-11-142

Open Data