Table 1

Bacterial strains, plasmids, and primers used in this study

Strain or plasmid

Relevant characteristics

Source/reference


S. aureus strain

RN4220

8325-4 derivative that accept foreign DNA

[55]

R cls1

RN4220 ΔSA1155; Cmr

This study

R cls2

RN4220 ΔSA1891; Tetr

This study

R cls1/cls2

RN4220 ΔSA1155/ΔSA1891; Cmr Tetr

This study

N315

pre-methicillin resistant strain

[56]

N cls1

N315 ΔSA1155; Cmr

This study

N cls2

N315 ΔSA1891; Tetr

This study

N cls1/cls2

N315 ΔSA1155/ΔSA1891; Cmr Tetr

This study

8325-4

NCTC 8325 cured of prophages, rsbU(-)

[57]

8 cls1

8325-4 ΔSA1155; Cmr

This study

8 cls2

8325-4 ΔSA1891; Tetr

This study

8 cls1/cls2

8325-4 ΔSA1155/ΔSA1891; Cmr Tetr

This study

SH1000

8325-4 derivative, rsbU repaired, rsbU(+)

[58]

S cls1

SH1000 ΔSA1155; Cmr

This study

S cls2

SH1000 ΔSA1891; Tetr

This study

S cls1/cls2

SH1000 ΔSA1155/ΔSA1891; Cmr Tetr

This study

MT01

isolate from healthy host, able to generate L-form

This study

MT01 cls1

MT01 ΔSA1155; Cmr

This study

MT01 cls2

MT01 ΔSA1891; Tetr

This study

MT01 cls1/cls2

MT01 ΔSA1155/ΔSA1891; Cmr Tetr

This study

plasmids

pMAD

thermosensitive, pE194ts-based delivery vector

[53]

pMADcat1155

pMAD-based SA1155 targeting vector

This study

pMADtet1891

pMAD-based SA1891 targeting vector

This study

pHY300PLK

shuttle vector, tet (TetR)

Takara, Japan

pRIT5H

shuttle vector, cm(CmR)

[54]

primers

5'-3'

Tet-F(Sal)

CATATT

    GTCGAC
TAAGTGATGAAATACTG

Tet-R(EcoRI)

G

    GAATTC
CTGTTATAAAAAAAGGATCAAT

CAT(Sal)F

CGA

    GTCGAC
GATAAAGTGGGATATTTT

CAT(Eco)R

C

    GAATTC
CGGGGCAGGTTAGTGACATT

clsU1p

T

    GGATCC
TGATATTGCTTACATACT

clsU2p

TGG

    GTCGAC
AAAAAGTACAAATAGC

clsD1p

CAC

    AGATCT
TATGGACTTTAGAAGTT

clsD2p

TTT

    AGATCT
CAATATCATCCAAATTA

1891U1

C

    GGATCC
AATAGTCCGACGATAGCT

1891U2

GAA

    GTCGAC
GTCCTAATAGTAAGTA

1891D1

T

    GAATTC
ACAAAAGCACGTTATGCT

1891D2

TGA

    AGATCT
AACATCACAACGGCATA


Cm: chloramphenicol, Tet: tetracycline

Tsai et al. BMC Microbiology 2011 11:13   doi:10.1186/1471-2180-11-13

Open Data