Table 2

Primers utilized in this work

Primers

Sequence

Annealing temperature

Amplicon length (bp)

Purpose


glnB_sfint

CGCCGCGATACAGCTCGGTATG

57°C

2108

glnB region isolation


revsf_glnBint

GATGGACGATCAGTTGGTCGA

57°C

2108

glnB region isolation


glnA_aa_do

ACGGTCGGCACTTCCTTCAG

53°C

1621

glnB region isolation


pglnB_up_BamHI

CG

    GGATCC
TCGTCGAAGCTGAAGGTCAT

55°C

727

glnB promoter amplification


pglnB_do_NcoI

GATCTTTT

    CCATGG
CTTACGGC

55°C

727

glnB promoter amplification


pglnK_up_BamHI

CG

    GGATCC
TTGTCCAGTGCCACGCTCAT

55°C

328

glnK promoter amplification


pglnK_do_NcoI

CACGAGCT

    CCATGG
GTAGTCC

55°C

328

glnK promoter amplification


Kglndel_A _EcoRI

AT

    GAATTC
CAATGCACAGGGTGCGTA

55°C

574 (AB) and 1111 (AD)

glnK mutagenesis


Kglndel_B

CCCATCCACTAAACTTAAACACGCCACCACGAGCTTCAT

55°C

574

glnK mutagenesis


Kglndel_C

TGTTTAAGTTTAGTGGATGGGATGACCATCGCCGACGCG

55°C

558

glnK mutagenesis


Kglndel_D_BamHI

CG

    GGATCC
CGATGGTGGGCGGATATTTG

55°C

558 (CD) and 1111 (AD)

glnK mutagenesis


glnK_NdeI_up

GGACTA

    CATATG
AAGCTCGTGGTG

60°C

361 (wt) or 121 (mut)

glnK mutagenesis verification


glnK_BamHI_do

CGTCACG

    GGATCC
TCATAAGGC

60°C

361 (wt) or 121 (mut)

glnK mutagenesis verification


conf_glnK_up

GCCCCCTCCAGGATCTTC

55°C

1522 (wt) or 1282 (mut)

glnK mutagenesis verification


conf_glnK_do

GGGTAAAATGCCCTTGTCCA

55°C

1522 (wt) or 1282 (mut)

glnK mutagenesis verification


Underline - restriction sites; Bold - sequence tag; wt - wild-type; mut - mutant; AB - amplification using the primers KglndelA_EcoRI and KglndelB; AD - amplification using the primers Kglndel_A_EcoRI and Kglndel_D_BamHI; CD - amplification using the primers KglndelC and Kglndel_D_BamHI

Sant'Anna et al. BMC Microbiology 2011 11:107   doi:10.1186/1471-2180-11-107

Open Data