Table 4

Oligonucleotides used in PCR or for DNA sequence analysis

Gene

Primer sequencesa

Relative position in Rd

Use


licA

Fb: GTAGGATTTGTTAAAACTTGCTACAAGCC

1608693

probe

R: GGCAATTCCTCTAACAGTTTAAATGCTGCG

1609579

licA

5'F1: GAATAAATTCATAAGAYTCAGAGCCTTAC

1608523

lic1 locus

5'F2: CAGCTAACCGAGCTTGGGTGAGAAAGTGG

1608476

and

mid R: GGCGAAACTCATCGAATACGC

1609107

5'-CAAT-

3'R: GCCCAAAATACAGCGGACAG

1609626

3'

licB

F: ATGCGTGGCTATCTCTTTGGCATAC

1609583

probe

R: TCATTTTTGTTCCCCTTTGTAATAAAGTG

1610461

licB

5'F: GTTATTTGATATAGCGACGATCATTGAGG

1609316

lic1 locus

mid F: CGGATTCGCCTTGGCTATTATTTCTTCTTCG

1609957

mid R: GAGGATATCACTATTTCAGATGACCACCC

1610091

3'R: GTGTAAATACCCTGTAACAATGACAATATTATCG

1610628

licC

F: ATGAATGCAATCATTTTAGCAGCAGG

1610458

probe

R: ATGTGGTGATAGTCATCAAGGTTATCC

1611125

licC

mid F: CGTATTGATATTGGTTCACTGAATCAACCC

1610884

lic1 locus

licD

F: ATGAAAAAATTGACTCTCAGAG

1611159

probe

R: TTACAAAATATACGCTTCTTGAATATG

1611956

licD

5'F: AATTGGGATACCATTCCGATGG

1611016

lic1 locus

3'R: AAGGGGCGCAAGAGCAGTTAG

1612129

and licD alleles


a All oligonucleotides based on DNA sequences from H. influenzae strain Rd or from H. haemolyticus lic1 sequence in this paper to make dot-blot hybridization probes or sequence the lic1 locus, the licD gene alleles, or the licA gene tetranucleotide repeats

b Forward primer begin downstream of licA gene tetranucleotide repeats

McCrea et al. BMC Microbiology 2010 10:286   doi:10.1186/1471-2180-10-286

Open Data