Table 2

Oligonucleotides used in the present study

Oligonucleotide name

Sequence (5' to 3')

Application


33intUP

CTGGTGACGTTGCTGGTACA

Construction of the omp33::TOPO mutant

33intDW

CGTTACCGATGATACCGAAG

Construction of the omp33::TOPO mutant

33extUP

CCTTAACATTACGTTTCATC

Confirmation of the omp33::TOPO mutant

33extDW

CATGTAAGATGCACCAACTGC

Confirmation of the omp33::TOPO mutant

Kmup

CCGGAATTGCCAGCTGGG

Kanamycin amplification

Kmdw

TTCAGAAGAACTCGTCAAG

Kanamycin amplification

33upFW

GCTGAGCTCGTAAAGTCTGATG

Construction and confirmation of the Δomp33::Km mutant

33upintRV

CCCAGCTGGCAATTCCGGGGCTAATAATACAGCAGTGG

Construction of the Δomp33::Km mutant

33dwintFW

CTTGACGAGTTCTTCTGAAGGCTTAAATGCTAAATTCCG

Construction of the Δomp33::Km mutant

33dwRV

CGTTGCCTTTTACCGTAGTC

Construction and confirmation of the Δomp33::Km mutant

33FWnest

GCAATTGAATTGTGTGAC

Construction of the Δomp33::Km mutant

33RVnest

TGATAGCAATTCAAGAGG

Construction of the Δomp33::Km mutant

OxyupFW

AGTTAAAAAAAATTGAAGAAA

Construction and confirmation of the ΔoxyR::Km mutant

OxyupintRV

CCCAGCTGGCAATTCCGGTCACTTGATGATCTCGATTTA

Construction of the ΔoxyR::Km mutant

OxydwintFW

CTTGACGAGTTCTTCTGAATGAAGATCACCAGTTAATGG

Construction of the ΔoxyR::Km mutant

OxydwRV

TATATTAACCATATTGAAGCC

Construction and confirmation of the ΔoxyR::Km mutant

OxyFWnest

GCAACTTGATGCAGCGGT

Construction of the ΔoxyR::Km mutant

OxyRVnest

TCAACGTAGCTACTATCC

Construction of the ΔoxyR::Km mutant

SoxupFW

ATGAAAGAAAAAAACTATATA

Construction and confirmation of the ΔsoxS::Km mutant

SoxupintRV

CCCAGCTGGCAATTCCGGATATTTACTTAGGGCTTGTTT

Construction of the ΔsoxS::Km mutant

SoxdwintFW

CTTGACGAGTTCTTCTGAAGAACAATGTCCATT AGAAA

Construction of the ΔsoxS::Km mutant

SoxdwRV

TCTGACTTCGTTTTTTGCTTA

Construction and confirmation of the ΔsoxS::Km mutant

SoxFWnest

AATTGCACGTTGCGATAG

Construction of the ΔsoxS::Km mutant

SoxRVnest

TAAACCAGATAGCCCAAC

Construction of the ΔsoxS::Km mutant

ATG33XbaI*

ATCGTCTAGACCCAGCTTTATCTCTTGTTA

Cloning of the omp33 gene

STOP33NcoI*

ATCGCCATGGGGACTGGACTCAGGAAGATTTG

Cloning of the omp33 gene

SoxRTup

AGGAACTGTAATTGCACG

RT-PCR for soxR detection

SoxRTrv

CCAATCGAGAGATAGCTC

RT-PCR for soxR detection

OxyRTup

ATGGCTGCATTACCCTCACT

RT-PCR for oxyR detection

OxyRTrv

GCGCTCTACAATCTTCTCAC

RT-PCR for oxyR detection

GyrBup

ATGAGTTCAGAGTCTCAATCA

RT-PCR for gyrB detection

GyrBrv

CTGTTAAACCTTCACGCGCAT

RT-PCR for gyrB detection

T7

AATACGACTCACTATAGGG

Universal primer of the pCR-BluntII-TOPO plasmid

SP6

ATTTAGGTGACACTATAG

Universal primer of the pCR-BluntII-TOPO plasmid

pETRAFW

TTCTTCGTGAAATAGTGATGATTTTT

Primer of the pET-RA plasmid

pETRARV

CTGTTTCATATGATCTGGGTATC

Primer of the pET-RA plasmid


*Oligonucleotides including the indicated restriction site (underlined)

Aranda et al. BMC Microbiology 2010 10:279   doi:10.1186/1471-2180-10-279

Open Data