Table 4

Oligonucleotides used for construction of targeted deletion mutants.

Gene(s)

Sequence 5' to 3'*

Name


exbD

1. TTAT

    GCATGC
GGTGATTGCTTCTGTTATTACTT GG

RJW115

2. GAATCAGTGACAATTACATAAGTCACCTTGTCTTG

RJW116

3. CAAGGTGACTTATGTAATTGTCACTGATTCTTCC

RJW117

4. TTAT

    GAGCTC
GCCAACCAATTTGCCTCTGCCCTAC

RJW118

yfeABCD

1. TTAT

    GCATGC
GGTTATCAATACCTGCCAGATGC

RJW171

2. CCCTTTTTGTTACATAAATTCAAACC

RJW172

3. GGTTTGAATTTATGTAACAAAAAGGGTTATATCTG

RJW173

4. TTAT

    GAGCTC
GGTGTTGAAGTTTGTTACTTATAGC

RJW174

feoABC

1. TTAT

    GCATGC
CGTAGTAAAAGCGGGTGATATCG

RJW167

2. GCTAATCATTTTCAATTCCTACATATGACCTTCCG

RJW168

3. CGGAAGGTCATATGTAGGAATTGAAAATGATTAGC

RJW169

4. TTAT

    GAGCTC
CCAAAACGCTTCTCTTAGAAGATGC

RJW170


*: the underlined sequence indicate the restriction endonuclease sites used for cloning the amplicon into pDS132.

Watson et al. BMC Microbiology 2010 10:177   doi:10.1186/1471-2180-10-177

Open Data