Table 3

Primer and probe sequences used for qPCR analysis.

Gene Name

Forward Primer

Reverse Primer

Probe


murZ

TGGTCCTTCATTTGTAACTGATACGATTT

CCCATGCGCTTTAATTCTTCAACAT

CCGGAGCGTTTTAAAC

atl

CCCTACTACACCATCAAAACCAACA

TGTGCGACACCATTGTTTGC

ACACCGTCGAAACCAT

ribB

CGTGCCATGAGTGGTAACG

GTTCATCTACATGACCGAGGACAAA

ATGTCCACCAAACCTAC

sgtB

GAGCTTTATTTTCAACGATTAGCGACA

AATTTTTGACAACTTGTTGTGTAATGGTACTAC

CACCTTGCACATCTC

oppB

TTTAGGTGTTGCAGCAGCTACT

GTACAGCAAGTACAAAAGATGGTACAGA

CAACCCAAGAATTTTG


Petek et al. BMC Microbiology 2010 10:159   doi:10.1186/1471-2180-10-159

Open Data