Table 3

Primers used in PCR survey for presence of fhu genes

Primera

Sequence 5' to 3'


R2846.1773(fhuC)_F

GGTTCGATTTCGTTGGACG


R2846.1773(fhuC)_R

GACGATTTGCTGTGCGTC


R2846.1774(fhuD)_F

CAGTGGGCGATATGCAAAG


R2846.1774(fhuD)_R

GTTTGGCGAGTTCGGTG


R2846.1775(fhuB)_F

GCGCAAAACCATGTCGC


R2846.1775(fhuB)_R

GTCGGGAAACTGAGTTGC


R2846.1777(OMP)_F

CGTCACTTTATCCAGCATCAG


R2846.1777(OMP)_R

GATAGCGTATCGGAAGC


R2846.1778(orf5)_F

GCTTAGCACGCAGTACG


R2846.1778(orf5)_R

CTCCTCTGTGTATTAAATTCC


a Primer pairs used to assay for each gene.

Morton et al. BMC Microbiology 2010 10:113   doi:10.1186/1471-2180-10-113

Open Data