Table 4

Oligonucleotide sequences used in this study.

Primer

Sequence (5'-3')

Gene

Comments


flgE-F

GGCTAACGAGCGTGGATAAG

flgE

FP of flgE

flgE-R

GAGCGAGCGCTAAAGTCCTA

flgE

RP of flgE

era-F

AAGGCTAATGCGACCAGAAA

hp0517

FP of era

era-R

GGAGCCCTGGTGTGTCTAAA

hp0517

RP of era

ML022FP

CGGGATCCCGGGGCGAAAGATTGGAGATTT

hp0256

Allelic exchange mutagenesis

ML027RP

CCATCGTAGATCTGGGCTGC AGCGAATTTTTTCATAGAAAAATCG

hp0256

Allelic exchange mutagenesis

ML028FP

GCAGCCCAGATCTACGATGGGCAATTAAAAAGCGCTCTAAGAAT

hp0256

Allelic exchange mutagenesis

ML023RP

CGGAATTCCGTTACGCATGCAAGCCCTC

hp0256

Allelic exchange mutagenesis

HP0256-F2

TATAACAAGGAGTTACAACAATGAAAAAATTCGCTTCTGTG

hp0256

FP of hp0256

HP0256-R

GCGCGCATCGATTTACGCATGCAAGCCCTCTT

hp0256

RP of hp0256

FLA-F2

GCGCGCGGATCCCATGCTCCTTTAAATTTTGC

flaA

FP of flaA promoter

FLA-R

TGTTGTAACTCCTTGTTATA

flaA

RP of flaA promoter

minD-F

TAATTTAGCGATCGGCTTGG

minD

FP of minD

minF-R

TCCATCACATCCACCACATC

minD

RP of minD

hp0610-F

ATAACGGCGTTCATTCTTGG

hp0610

FP of hp0610

hp0610-R

GCGGTTGTTATGCAAGGTTT

hp0610

RP of hp0610

omp6-F

GCCCGATTCTAAAGGGTTTC

omp6

FP of omp6

omp6-R

GGCCAAACTCTTTGGTGGTA

omp6

RP of omp6

hpn-F

ATGGCACACCATGAAGAACA

hpn

FP of hpn

hpn-R

GATGAGAGCTGTGGTGGTGA

hpn

RP of hpn

HP0256-QF

GCGCGCCCATGG AAAAATTCGCTTCTGTATTGG

hp0256

FP of hp0256

HP0256-QR

GCGCGCGGATCC TTACGCATGCAAGCCCTCTTT

hp0256

RP of hp0256


FP, forward primer; RP, reverse primer.

Douillard et al. BMC Microbiology 2010 10:106   doi:10.1186/1471-2180-10-106

Open Data