Table 2

Description of Bacillus anthracis polymorphic markers

Expected

Number

product

Estimated

of

Total

PIC

Marker

U

N

%

V

Primer sequences

PCR

length in

size

alleles

number

index

GC

bp

range

in B.

of

(observed)

(bp)

anthracis

alleles


Ceb-Bams 1

21

16

44

88

L: GTTGAGCATGAGAGGTACCTTGTCCTTTTT

485

410-520

5

5

0.72

R: AGTTCAAGCGCCAGAAGGTTATGAGTTATC

(520)

Ceb-Bams 3

15

25

59

73

L: GCAGCAACAGAAAACTTCTCTCCAATAACA

544

480-860

6

9

0.75

R: TCCTCCCTGAGAACTGCTATCACCTTTAAC

1%

Ceb-Bams 5

39

10

49

92

L: GCAGGAAGAACAAAAGAAACTAGAAGAGCA

53°C

307

305-385

3

3

0.56

R:ATTATTAGCAGGGGCCTCTCCTGCATTACC

60s

Ceb-Bams 7

18

49

55

69

L: GAATATTCGTGCCACCTAACAAAACAGAAA

65°C

1017

600-1950

9

9

0.82

R: TGTCAGATCTAGTTGGCCCTACTTTTCCTC

1%

Ceb-Bams 13

9

70

60

79

L: AATTGAGAAATTGCTGTACCAAACT

120s

814

330-850

8

11

0.79

R: CTAGTGCATTTGACCCTAATCTTGT

1%

Ceb-Bams 15

18

12

57

77

L: GTATTTCCCCCAGATACAGTAATCC

409

410-610

5

5

0.59

R: GTGTACATGTTGATTCATGCTGTTT

Ceb-Bams 21

45

11

43

75

L: TGTAGTGCCAGATTTGTCTTCTGTA

676

540-680

3

3

0.14

R: CAAATTTTGAGATGGGAGTTTTACT

Ceb-Bams 22

36

15

39

81

L: ATCAAAAATTCTTGGCAGACTGA

735

590-950

4

6

0.51

R: ACCGTTAATTCACGTTTAGCAGA

Ceb-Bams 23

42

11

37

85

L: CGGTCTGTCTCTATTATTCAGTGGT

653

570-820

3

4

0.49

R: CCTGTTGCTCCTAGTGATTTCTTAC

Ceb-Bams 24

42

11

44

80

L: CTTCTACTTCCGTACTTGAAATTGG

630

335-670

3

6

0.2

R: CGTCACGTACCATTTAATGTTGTTA

Ceb-Bams 25

15

14

45

60

L: CCGAATACGTAAGAAATAAATCCAC

391

375-390

2

2

0.07

R: TGAAAGATCTTGAAAAACAAGCATT

Ceb-Bams 28

24

14

36

70

L: CTCTGTTGTAACAAAATTTCCGTCT

493

300-400

3

3

0.26

R: TATTAAACCAGGCGTTACTTACAGC

(400)

Ceb-Bams 30

27

16

58

78

L: AGCTAATCACCTACAACACCTGGTA

120s

200-890

11

11

0.77

R: CAGAAAATATTGGACCTACCTTCC

1%

Ceb-Bams 31

9

64

58

57

L: GCTGTATTTATCGAGCTTCAAAATCT

772

300-850

4

4

0.32

R: GGAGTACTGTTTGTTGAATGTTGTTT

1%


Some structural characteristics of the tandem repeats are presented : U (unit length), N (number of repeats), %GC, V (% of conservation). PCR and electrophoresis conditions are as described in the material and methods section : annealing temperature is 60°C, elongation time is 60 seconds and gels are 2% agarose except when indicated otherwise. The expected product length is deduced from the sequencing data corresponding to the Ames strain. When the Ames strains typing does not fit with the expected value, the observed value is indicated between (). Only one side of the Ceb-Bams30 minisatellite can be identified in the available Ames sequence. The other side was identified in the course of the independent, partial sequencing of B. anthracis strains (Vergnaud and col., unpublished data). Total number of alleles includes alleles observed in the B. cereus strains. Polymorphism Information Index (PIC) or Nei's diversity index is calculated as 1 - Σ (allele frequency)2.

Le Flèche et al. BMC Microbiology 2001 1:2   doi:10.1186/1471-2180-1-2

Open Data