Table 1

Primer sequences used for Cyproquant assays Table shows position of amplification product within cDNA sequence (upper line) and within genomic sequence (lower line). GenBank accession numbers are indicated.

Gene name

5'-3' primer sequence

Position cDNA-gene

Accesion Number


IL-1β

FW

CCTGTCCTGCGTGTTGAAAGA

639–788

NM_000576

RW

GGGAACTGGGCAGACTCAAA

Int. Span.

M15840

IL-4

FW

AACAGCCTCACAGAGCAGAAGAC

177–278

BC070123

RW

GCCCTGCAGAAGGTTTCCTT

Int. Span.

AF395008

IL-10

FW

GCTGGAGGACTTTAAGGGTTACCT

210–318

AY029171

RW

CTTGATGTCTGGGTCTTGGTTCT

Int. Span.

AF418271

IL-12p40

FW

CATGGTGGATGCCGTTCA

636–767

AF180563

RW

ACCTCCACCTGCCGAGAAT

Int. Span.

AY008847

IL-13

FW

ACAGCCCTCAGGGAGCTCAT

135–231

NM_002188

RW

TCAGGTTGATGCTCCATACCAT

Int. Span.

AF377331

IL-15

FW

CCATCCAGTGCTACTTGTGTTTACTT

351–466

U14407

RW

CCAGTTGGCTTCTGTTTTAGGAA

Int. Span.

X91233

IL-18

FW

GACGCATGCCCTCAATCC

966–1071

NM_001562

RW

CTAGAGCGCAATGGTGCAATC

Exon

E17138

IFN-γ

FW

GTTTTGGGTTCTCTTGGCTGTTA

151–263

NM_000619

RW

AAAAGAGTTCCATTATCCGCTACATC

Int. Span.

AF375790

MIF

FW

GCCCGGACAGGGTCTACA

322–399

M25639

RW

CTTAGGCGAAGGTGGAGTTGTT

Int. Span.

L19686

TGF-β1

FW

CAAGGGCTACCATGCCAACT

1786–1869

NM_000660

RW

AGGGCCAGGACCTTGCTG

Int. Span.

X05839

TNF-α

FW

CCCCAGGGACCTCTCTCTAATC

358–455

NM_000594

RW

GGTTTGCTACAACATGGGCTACA

Int. Span.

AB088112

β2-MG

FW

AATTGAAAAAGTGGAGCATTCAGA

255–389

NM_004048

RW

GGCTGTGACAAAGTCACATGGTT

Exon

M17987

UBC

FW

ATTTGGGTCGCGGTTCTTG

20–152

BC039193

RW

TGCCTTGACATTCTCGATGGT

Int. Span.

D63791

YWHAZ

FW

ACTTTTGGTACATTGTGGCTTCAA

1090–1183

NM_003406

RW

CCGCCAGGACAAACCAGTAT

Exon

NC_000008


Note: FW = Forward primer; RW = Reverse primer; Int. Span. = Intron spanning, i.e. Primers derived from different exons; Exon = both primers derived from the same exon. β2-MG = β2-microglobulin. UBC = Ubiquitin C. YWHAZ = tyrosine 3-monooxygenase tryptophan 5-monooxygenase activation protein, zeta polypeptide.

Boeuf et al. BMC Immunology 2005 6:5   doi:10.1186/1471-2172-6-5

Open Data