Table 3 |
|||||
|
Vκ cRS cleaved in 103/BCL2 cells and pre-B cells from RAG2:GFP and C57BL/6 mice. |
|||||
|
Cell Type |
Position |
N |
cRS sequence |
Vκ gene |
RIC23 |
|
|
|||||
|
103BCL2 |
232 |
1 |
cactgaa cctgtttgggactcctgaggcca gattggaca |
2–116 |
-76.53 |
|
103BCL2 |
238 |
1 |
cactAct ggagaaCcgggatgggactccag gacgaagag* |
17–127 |
-72.20 |
|
103BCL2 |
282 |
2 |
cacagtg ctgatggtgaaagtgaaatccgt cccatatcc |
6–32 |
-52.01 |
|
103BCL2 |
282 |
1 |
cacactg ttgatactgagagtgaaatctga ccctgatcc |
5–39 |
-54.66 |
|
103BCL2 |
282 |
1 |
cacactg ttgatactgagagtgaaatctgt ccctgatcc |
5–45 |
-54.66 |
|
BM pre-B |
282 |
2 |
cacagtg ctgatggtgaaagtgaaatccgt cccatatcc |
6–32 |
-52.01 |
|
BM pre-B |
288 |
1 |
agcatgc acattgctaatggtgagagtgaa gtctgtccc |
8–26 |
NA |
|
103BCL2 |
313 |
1 |
cacagta ataaacacccacatcctcagcct ccactctgc |
2–116 |
-62.49 |
|
103BCL2 |
313 |
1 |
cacagta ataaacacccacatcctcagcct ccactctgc |
2–109 |
-62.49 |
|
103BCL2 |
327 |
1 |
gccatga ttgtgctgacagtaataaactgc taggtcttc |
8–18 |
NA |
|
103BCL2 |
342 |
1 |
cactgtg tgaggccagctgttactctgttg acagaaata |
5–45 |
-65.18 |
|
103BCL2 |
342 |
1 |
cactgtg ggagggagatacctatgctgtag acagaaata |
11–106 |
-69.65 |
|
BM pre-B |
342 |
2 |
cactgtg ggaggagagctataatcctgctg acagaaata |
6–32 |
-66.82 |
|
103BCL2 |
342 |
1 |
cactgtg ggaggagagctataatcctgctg acagaaata |
6–32 |
-66.82 |
|
103BCL2 |
342 |
1 |
cactgtg ggaggaaactcataaaactgtag acagtaata |
14–130 |
-70.3 |
|
BM pre-B |
342 |
1 |
cactgtg ggaggaaactcataaaactgtag acagtaata |
14–130 |
-70.3 |
|
|
|||||
|
LM-PCR products from 103/BCL2 cells and from pre-B cells isolated from RAG2:GFP knock-in mice or from C57BL/6 mice were sequenced and aligned to sequences from the IMGT reference directory set to identify the germline gene segment. Where matches to IMGT sequences were not found, the LM-PCR products were aligned to germline Vκ gene segments in NCBI (indicated in bold). The source, location, number of observations, cRS sequence, Vκ gene segment, and cRS sequence RIC score are shown for each independent cleavage event. cRS sequences are written in heptamer-to-nonamer orientation, and nucleotide positions using IMGT numbering indicate the location of the first heptamer nucleotide. * The LM-PCR product shows 2 mismatches to the genomic cRS sequence (cactGctggagaaTcgggatgggactccaggacgaagag), indicated with capital letters. We attribute this difference to sequencing error. |
|||||
|
Lieberman et al. BMC Immunology 2009 10:37 doi:10.1186/1471-2172-10-37 |
|||||