Table 1

Oligomers used for RT-PCR

Oligomer

Sequence (5'-3')

Expected amplicon length (bp)

MDR1-F

CACCGTTATGGAACCAGTTG

330

MDR1-R

CAGCACCAAACAATGGACCAACCCAATGAG

orf19.1582-F

GAAACTTTGGTATCCTGGAAC

380

orf19.1582-R

CAACAAAATGGCAAAACCACC

orf19.7336-F

CGCTTTCCAACCATCAATGG

464

orf19.7336-R

CAGTCATTGAAGAAGCAGAAG

orf19.4090-F

GAGAAGGGGCGTTTTTATTG

301

orf19.4090-R

CACAATGAAAACCGGTAACAC

orf19.6180-F

GGTTGTTGTTAGGTGTGTTG

394

orf19.6180-R

CAAAATCTCGTAAACCCACG

orf19.1424-F

CAGTACAAACATTACAAGCCC

476

orf19.1424-R

CACCACAAATGTCATACCAC

orf19.6520-F

GCCTTACATCCACGCAATTTG

339

orf19.6520-R

CTAAAATCTAACCTCTTGGCGC

orf19.6654-F

CTATTGGGTTGTTGGGTTTG

286

orf19.6654-R

GTCGAGCCTCCAATAATACCTG

orf19.6976-F

CTCCCCCTTGGTTATATTAAC

603

orf19.6976-R

CCAGGCCAACCATTTTTCAAAG


Gaur et al. BMC Genomics 2008 9:579   doi:10.1186/1471-2164-9-579

Open Data