Table 2

Transcript level comparison of P. aeruginosa genes between real-time PCR and microarray analyses

Gene

amRNA level change with microarray

bmRNA level change with real-time PCR

Forward primer sequence (5'-3')

Reverse primer sequence (5'-3')


Fold change

Fold change


20 min

60 min

20 min

60 min


PA4243

2.914

6.799

3.605 (± 1.55)

7.378 (± 0.7)

ATGGCTAAGCAAGGTGCTCTCTCT

ACGATGATCGCCAGGAACAGGAAA

PA2193

-2.268

-1.967 (± 1.06)

TGAACGTCAACACGATATCCAGCC

ATTGAGCACGTTGAGCACGGTCT

PA1173

-3.077

-3.03 (± 5.64)

ATCGACAAGGACAGCAACAAGTGC

GTCCATGTAGTGGGTGATGCTGAT

PA3049

-6.25

-25.907

-10.196 (± 0.14)

-48.503 (± 0.35)

TCGTGATCTTTGTCCGTTCACCCA

CGTGCTGGAGTTGATTGAGACGTT

PA3724

-2.762

-10.256

-5.856 (± 0.21)

-14.928 (± 1.27)

TCATCACCGTCGACATGAACAGCA

AGTCCCGGTACAGTTTGAACACCA

PA3622

-2.653

-2.967

-1.954 (± 1.95)

-5.924 (± 1.60)

TGACCACGATGATGAAGTGCTCCT

TTGGAAGAGAAGGAAGTGGTGGCT

cPA3001

1.00

1.00

1.00

1.00

GCACCATCACCATCGACGAAGAAA

TCTTGATGCCGTACTGGGTGTAGT


The real time PCR results are the mean of three biological replicates with three technical replicates for each gene. The microarray results are the mean of four replicates of each gene.

aThe microarray results are the mean of four replicates of each gene.

bThe real time PCR results are the mean of three biological replicates with three technical replicates for each gene.

cInternal control: glyceraldehyde-3-phosphate dehydrogenase

Nde et al. BMC Genomics 2008 9:473   doi:10.1186/1471-2164-9-473

Open Data