Software
Human MLPA Probe Design (H-MAPD): a probe design tool for both electrophoresis-based and bead-coupled human multiplex ligation-dependent probe amplification assays
-
* Corresponding author: Jizu Zhi jzhi@ic.sunysb.edu
BMC Genomics 2008, 9:407 doi:10.1186/1471-2164-9-407
- A brief comparison between H-MAPD and ProSeek
- A brief comparison of H-MAPD vs. ProSeek
- Another MLPA Probe Design Tool published in BMC Genomics
A brief comparison of H-MAPD vs. ProSeek
Jizu Zhi
(2009-02-05 10:46) Stony Brook University 
A paper describing a similar program (ProSeek) was published on 28 November 2008 in
the same journal (BMC Genomics). We received questions from readers regarding the
differences between H-MAPD and ProSeek. A brief comparison between the two programs
is summarized below:
1) H-MAPD calculates Tm using UNAFold and compares results between UNAFold and RAW
(a Tm calculation software used by MRC-Holland); ProSeek article doesn't mention how
Tm is calculated. A comparison of Tm values for a few sequences (from the additional
tutorial file of the ProSeek paper) is demonstrated below:
Sequences:
sequence_A (24 nt): CCGAGTGAGAAAGTTTCCCACGT
sequence_B (27 nt): CCGAGTGAGAAAGTTTCCCACGTTCA
sequence_C (30 nt): CCGAGTGAGAAAGTTTCCCACGTTCATTCT
sequence_D (33 nt): CCGAGTGAGAAAGTTTCCCACGTTCATTCTTGT
Tm Calculated by H-MAPD vs. ProSeek
Sequences *H-MAPD ProSeek
sequence_A: 58.13 71.63
sequence_B: 61.29 74.20
sequence_C: 66.12 75.95
sequence_D: 69.94 77.74
*H-MAPD: Tm calculation was based on 0.35M [Na+] and 0.0M [Mg2+].
2) H-MAPD evaluates interferences of non-specific homologue sequences by their Tm;
ProSeek evaluates interferences of non-specific homologue sequences by the e-value
of alignment.
3) H-MAPD incorporates secondary structure evaluation in the screening process; ProSeek
provides a link for users to manually verify secondary structure for each probe set.
4) H-MAPD provides up to 50 different pre-verified stuffer sequences for each submission;
ProSeek allows one stuffer sequence for each submission.
5) Some unique features of H-MAPD: allows users to specify the maximum copy number
of query sequences in the target genome; allows users to view failed probe sets so
that users can manually verify results; takes SNPs into consideration.
Competing interests
None
Another MLPA Probe Design Tool published in BMC Genomics
Maria Kowalczuk PhD (2009-01-05 10:49) BioMed Central Editorial Department
See also article by Pantano et al. "ProSeeK: A web server for MLPA probe design" published in BMC Genomics on 28 November 2008.
Competing interests
None declared
A brief comparison between H-MAPD and ProSeek
Jizu Zhi (2009-02-11 11:56) Stony Brook University
A paper describing a similar program (ProSeek) was published on 28 November 2008 in the same journal (BMC Genomics). We received questions from readers regarding the differences between H-MAPD and ProSeek. A brief comparison between the two programs is listed below:<br><br>1) H-MAPD calculates Tm using UNAFold and compares results between UNAFold and RAW (a Tm calculation software used by MRC-Holland); ProSeek doesn't mention how Tm is calculated. A comparison of Tm values for a few sequences (from the additional tutorial file of the ProSeek paper) is demonstrated below:<br><br> Sequences:<br> sequence_A (24 nt): CCGAGTGAGAAAGTTTCCCACGT<br> sequence_B (27 nt): CCGAGTGAGAAAGTTTCCCACGTTCA<br> sequence_C (30 nt): CCGAGTGAGAAAGTTTCCCACGTTCATTCT<br> sequence_D (33 nt): CCGAGTGAGAAAGTTTCCCACGTTCATTCTTGT<br><br> Tm Calculated by H-MAPD vs. ProSeek<br> Sequences *H-MAPD ProSeek<br> sequence_A: 58.13 71.63<br> sequence_B: 61.29 74.20<br> sequence_C: 66.12 75.95<br> sequence_D: 69.94 77.74<br><br> *H-MAPD: Tm calculation was based on 0.35M [Na+] and 0.0M [Mg2+].<br><br>2) H-MAPD evaluates interferences of non-specific homologue sequences by their Tm; ProSeek evaluates interferences of non-specific homologue sequences by the e-value of alignment.<br><br>3) H-MAPD incorporates a secondary structure evaluation in the screening process; ProSeek provides a link for users to manually verify secondary structure for each probe set.<br><br>4) H-MAPD supports both electrophoresis-based and bead-coupled MPLA; ProSeek supports electrophoresis-based MLPA only.<br><br>5) H-MAPD provides up to 50 different pre-verified stuffer sequences for each submission; ProSeek allows one stuffer sequence for each submission.<br><br>6) Some unique features of H-MAPD: allows users to specify the maximum copy number of query sequences in the target genome; allows users to view failed probe sets so that users can manually verify results; takes SNPs into consideration.<br>
Competing interests
None declared
top