BMC Genomics

official impact factor 4.21

Open Access Highly Access Software

Human MLPA Probe Design (H-MAPD): a probe design tool for both electrophoresis-based and bead-coupled human multiplex ligation-dependent probe amplification assays

Jizu Zhi* and Eli Hatchwell

Author Affiliations

Genomics Core Facility, School of Medicine, Stony Brook University, Stony Brook, NY 11794, USA

For all author emails, please log on.

BMC Genomics 2008, 9:407 doi:10.1186/1471-2164-9-407

Published: 10 September 2008

Additional files

Additional file 1:

Diagram of electrophoresis-base MLPA. Two sequence-tagged half probes are annealed to adjacent sites on the genomic target sequence and ligated using a thermostable DNA ligase. The ligated probes are subsequently amplified with universal primers (one of which is fluorescently labeled) and quantified using electrophoresis. By inserting different-sized stuffer sequence between hybridizing sequence and primer sequence, or by extending the length of the hybridizing sequences, each product has a distinct size, which allows for identification by electrophoresis. The default left and right primers used in H-MAPD are GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC, respectively. These are the same primers included in the commercial MRC-Holland MLPA kits.

Format: GIF Size: 11KB Download file

Open Data

Additional file 2:

Diagram of bead-coupled MLPA. Similar to electrophoresis-based MLPA, except that the stuffer sequence is replaced by a fixed-length bead tag. Identification of distinct sequences is based on association with a distinct bead. Bead tags can be inserted either between the left primer and the LHS or between the RHS and the right primer. The default left and right primers used in H-MAPD are GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC, respectively. These are the same primers included in the commercial MRC-Holland MLPA kits.

Format: GIF Size: 12KB Download file

Open Data

Additional file 3:

Stuffer sequences. The stuffer sequences (used in electrophoresis-based MPLA) are from different locations of the Lambda genomic sequence with minor modifications. To ensure that the union of primer and stuffer sequence itself does not fail any of the criteria, firstly all (default left primer GGGTTCCCTAAGGGTTGGA + left stuffer) sequences and (right stuffer + default right primer TCTAGATTGGATCTTGCTGGCAC) sequences were verified to be free of secondary structure at 60°C and 0.35 M Sodium concentration; secondly the maximum Tm of primer and stuffer union sequences to the human genome is verified to be less than 55°C; thirdly no self or inter-probe annealing is detected for all (left primer + left stuffer) and (right stuffer + right primer) sequences.

Format: PDF Size: 20KB Download file

This file can be viewed with: Adobe Acrobat Reader

Open Data

Additional file 4:

FlexMAP bead tag sequences. FlexMAP bead tag sequences (used in bead-coupled MPLA) are commercially available. ΔG and maximum Tm to the human genome was calculated for (default left primer GGGTTCCCTAAGGGTTGGA + tag) and (tag + default right primer TCTAGATTGGATCTTGCTGGCAC) union sequences. Some of the tag sequences are not suitable for certain MLPA assays. For example, the tag corresponding to bead 062 or bead 071, when attached to the right primer, has a secondary structure that is significant (ΔG = -1.538 and -1.514 respectively).

Format: PDF Size: 83KB Download file

This file can be viewed with: Adobe Acrobat Reader

Open Data

Additional file 5:

Comparison of Tm calculated by RAW and UNAFold. Melting temperatures of reference sequences mentioned in the MRC-Holland MLPA probe design guidelines, were calculated using two different software, RAW and UNAFold (version 3.5), at 0.35 M Sodium concentration. Tm calculated by RAW is on average 9.1°C higher than that calculated by UNAFold with a standard deviation of 2.8°C.

Format: PDF Size: 10KB Download file

This file can be viewed with: Adobe Acrobat Reader

Open Data