Table 3

Oligonucleotide primers used in this study

Primer

DNA sequence (5' → 3')

Reference or source


Construction of Δso2426 strain


Del840-F

CTTGGTTACCGGCTAGTGAAC

This study

Del840-R

GGCAGGTATTGATAACAATGA

This study

Del900-F

GGTTCACACCAATCGCATTAG

This study

Del900-R

TGGCCAATACCCGCTTACCGC

This study

ISU2426

GCCTAAGATGCCATCAGT

This study

ISD2426

TCTTCAAGATTTAGCTTATCC

This study

OP840

CACATAAGGCAGACCTTCGTC

This study

OP900

ATGGTCCGTACTGTGGCCGC

This study

kanF

ATTGTTGATGCGCTGGCAGT

[32]

kanR

TCCGGTGAGAATGGCAAAAG

[32]


Construction of complementation plasmid


2426com-F

ACACACAAGCTTGCGCTTTTCTTTTAGGTACAA

This study

2426com-R

ACACACGGATCCGACTCACAGAGGGCGCTTA

This study


RT-PCR analysis


P1

ATGATATTGATTCTCGTTTG

This study

P2

CCGAGTGTGGTTAACTGATG

This study

P3

CGCCGAGTATTACTGATATGC

This study

P4

AAGCGCTAAAACTGTATCC

This study

P5

TTAACATGCATCTACTTTTA

This study

P6

GATCTTGCAGGTTGTTGTT

This study

P7

TCATACACTCTTTCGCTTAT

This study

P8

CTGTTTCTTCAACTCAGCCT

This study

P9

CAGTCGTTAGCTCAATTGCT

This study


Chourey et al. BMC Genomics 2008 9:395   doi:10.1186/1471-2164-9-395

Open Data