Table 4

RT-PCR oligonucleotide primers and conditions.

Gene description

Upstream/downstream primer sequences (5'-3')

PCR annealing conditions


R. microplus


GI [Genbank:EU436162]

CACCATCACTGAAAGCGGT

GTGTTAAATAGTTATGCTCATTAAGAC

50°C, 30 sec

GII [Genbank:EU436163]

GATCATTGACCTGGTACCTTCC

GACTTGATGACACCGACGG

50°C, 30 sec

Subolesin [Genbank:DQ923495]

CACAGTCCGAGTGGCAGAT

GATGCACTGGTGACGAGAGA

50°C, 30 sec

Beta actin [Genbank:AY255624]

CAC GGT ATC GTC ACC AAC TG

TGA TCT GCG TCA TCT TCT CG

50°C, 30 sec


I. scapularis


Putative secreted salivary WC peptide [Genbank:AAY66498]

GATATTGATCCAGCCGGAGA

ATGTCGTCCCTCCATTGTGT

60°C, 30 sec

Putative secreted protein [Genbank:AAM93633]

TGAAGGCAACCATTGCAGTT

ATTGATGGCAATCCTGTGGA

56°C, 30 sec

Identical to M. rosenbergii Cu-Zn SOD [Genbank:AAZ29240]

TGACCTGGGCAACGTTGA

ATGACGCAGCAGGCAATG

54°C, 30 sec

Subolesin [Genbank:AY652654]

AGCAGCTCTGCTTCTCGTCT

TCGTACTCGTCGCGTATCTG

54°C, 30 sec

Beta actin [Genbank:AF426178]

GAGAAGATGACCCAGATCA

GTTGCCGATGGTGATCACC

50°C, 30 sec


de la Fuente et al. BMC Genomics 2008 9:372   doi:10.1186/1471-2164-9-372

Open Data