Additional file 2.

Organization of mobile integrase cassettes (MIC) in B. longum DJO10A. (A) and NCC2705, (B). Orfs 1, 2 and 3 refer to three contiguous, but different xerC integrase genes. P, a conserved 20 bp palindrome (TTAAACCGACATCGGTTTAA), which has a 11 bp extension in MIC III. IR, 96 bp inverted repeat (IR) (GATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCCGTGTCCCATGTGGTTTCCCGGCTTAACGTTCCGGGTTAT), that has a 3 bp extension in MIC I and II, a 5 bp extension in MIC III and a 1 bp extension in MIC 1, 2 and 3. IS, insertion sequence.

Format: PDF Size: 31KB Download file

This file can be viewed with: Adobe Acrobat Reader

Lee et al. BMC Genomics 2008 9:247   doi:10.1186/1471-2164-9-247