Table 3

Novel miRNAs

miRNA name (cluster name)

mature sequence of novel miRNA

reads

Predicted precursor of novel miRNA location / comments


hsa-mir-1469 (srclusterF2762)

CUCGGCGCGGGGCGCGGGCUCC

1

chr15:94,677,494-94,677,540 (+) / intron of NR2F2

hsa-mir-1251 (srclusterF3130)

ACUCUAGCUGCCAAAGGCGCUU

1

chr12:96,388,159-96,388,215 (+) / intron of RMST

hsa-mir-1470 (srclusterF891)

GCCCUCCGCCCGUGCACCCCG

1

chr19:15,421,359-15,421,419 (+) / antisense intron of WIZ

hsa-mir-675b (srclusterR1978)

CUGUAUGCCCUCACCGCUCAG

3

chr11:1974572-1974628 (-) / star sequence of miR-675

hsa-mir-1471 (srclusterR2035)

GCCCGCGUGUGGAGCCAGGUGU

1

chr2:232,582,457-232,582,513 (-) / intergenic

hsa-mir-1468 (srclusterR3487)

CUCCGUUUGCCUGUUUCGCUG

1

chrX:62,788,915-62,788,976 (-) / intergenic


Kawaji et al. BMC Genomics 2008 9:157   doi:10.1186/1471-2164-9-157

Open Data