Table 1

List of genes selected for validation by real-time RT-PCR

Gene Name

Fold regulation in microarray

Primer sequences


HPL1D cells

A549 cells


TGF-β induced protein 68 kDa (TGFBIP)

1.8

2.8

F 5' tgtgtgctgaagccatcgttg 3'

R 5' ccggcttgtctgaaaaggtca 3'

Trans membrane prostate androgen induced RNA (TMEPA)

1.5

3.08

F5'ttcattccctgtcctcattgg3'

R5'gcacaacagccatggaatca3'

Insulin like growth factor binding protein 7 (IGFBP7)

1.49

2.72

5' ggtccttccatagtgacgcc 3'

5' tctgaatggccaggttgtcc 3'

Matrix metalloprotease 2 (MMP2)

1.0

1.32

5' ctgatggcacccatttacacc 3'

5' gcctcgtataccgcatcaatc 3'

Transglutaminase 2 (TGM2)

1.2

3.27

5' ccatgaccagaacagcaacct3'

5' tgacctccgcaaagacaaag 3'

Thrombospondin 1 (TSP-1)

1.1

2.24

5' ccggcgtgaagtgtactagcta3'

5' tgcacttggcgttcttgtt 3'

Integrin αV

1.1

2.73

5' caggcttgcaacccattct 3'

5' cctggcgagtttggttttct 3'

RPL35a

5' gggtacagcatcactcgga 3'

5' acgcccgagatgaaacag 3'


The genes were selected based on any or both of the following criteria. 1. Genes that showed differential regulation between cell-lines and show maximum regulation in at least one of the cell-lines, 2. Genes that showed regulation in the array and are known as TGF-β regulated genes in other studies. The primer sequences are shown 5' to 3' and F and R denote forward and reverse primers respectively.

Ranganathan et al. BMC Genomics 2007 8:98   doi:10.1186/1471-2164-8-98

Open Data