Table 1

Target complementary regions and unique primer sequences for the PRI-lock probes.

Targeted species/group

5' Target complementary sequence (5'-3')

3' Target complementary sequence (5'-3')

Forward primer sequence (5'-3')

Reverse primer sequence (5'-3')


Phytophthora spp.

TATCTAGTTAAAAGCAGAGACTTTCGTC

CTGCTGAAAGTTG

    C

TACGAACGTCTTAGCACTCC

GGTGTTGATTCGCGTCTACT

P. infestans

TCGATTCGTGGTATGGTTGGCTTCGGCT

CGTTAATGGAG

    A
A
    A
TG
    C

AGAGTCGGTAGGCACTATGG

CGTATGTCGAATGCAGCTGA

R. solani AG 2-2

TCTGCCTCACAGGTTCACAGG

    T
GTGTGTGG

TTC

    C
CGT
    CCA
T
    G
T
    C

GAGTTCCCGTGCGTTAGATC

TACGGCGCTTGGGACATGAT

R. solani AG 4-1

GGTCCAATAAAGTTCCTTCCCCCC

    TAG
AAAA

AGTCCAA_GG

    A
GAGTA___

CGTGTCCATCGAGCTGCATA

GACGGCATTCAGAGTACGCT

R. solani AG 4-2

GACTTCTGTCTACTTAATTCATATAAACTCAATT

    CTT
_CTACTC
    CC
CCTT_

CTGCCTGTGACTCGTGTATC

AGACCGTATCGTCCACAGTG

F. oxysporum

GCGAGTCCCAACACCAAGCTG

    T
GCTTG

GGAACGCGA

    A
TTAAC_

CTGGTGCATGTACTCGACTG

ATCAGATCGACTCGGTAGCT

M. roridum

CGGTGGTGGCCATGCCGT

    A
AAACACC

    A
CTCGC
    A
TTGGA
    G
C
    T

CATCCAGCTCAACGTATCCA

CCTACTGTGACGCTGTGATG

V. dahliae

TTTATACCAACGATACTTCTGAGTGTT

CATCAGTCTCT

    C
T
    G

ATCTGGATCAACGTCGCGCT

ATACAGTCGTCGGGGTCGAA

V. alboatrum/V. tricorpus

TTTATACCAACGATACTTCTGAGTGTTCTTAGTGAAC

    G
T
    A
CATCAGTCTCT
    T
TA

GCATCGGGTTCACGCCTATA

TGAAGCACTGACACGCGAAG

M. hapla

G

    T
T
    TAT
CGTTGTGAATGGCTGTCGCTGGTG

ATT

    C
GAA
    TA
G
    TCTC
AA
    C

TATGGGTCTTGCTGATACGC

TCCGTCTGTTGAGTTAGGCC

E. carotovora carotovora

AAAACCTGTGCGTT

    C
ATCGATGCTGAACAT

TCA

    A
CGCGAAGG
    A

AGAATCGTACACGCTGCTGG

AATACGACTGACACGAGCTG

A. tumefaciens

TCCGGTTGATAGTTGAGGACAGCATTGGAC

GTTGGTCGTCCGCT

CAATACCTGTGACGAGCTGG

ACCCGGTCACTCAGCATATA

G. Proteo bacterial spp.

GGCCTTCTTCACACACGCGGCATGGCTGCA

GCTTTACAACCCGAA

ACAGGTCATCGAACTCTCAC

AGAACACGTCAGAGGTCCGT

Internal Ligation Control (ILC)

GGGAGAACACTGCGTGGTTTTCACATAC

GCTTGTGCCTCTCGA

CTATCGCGTGCTAGTCGTCT

ATTCTAATCAATCGTCGCGG


Nucleotides highlighted in bold font, indicate polymorphism within the target group. Nucleotides or gaps owing to deletions used to discriminate from most similar, non-target sequences, are underlined. (No such sequence was found for the PRI-lock probes G. Proteo bacterial spp. and A. tumefaciens)

van Doorn et al. BMC Genomics 2007 8:276   doi:10.1186/1471-2164-8-276

Open Data