Table 2

List and characteristics of oligonucleotides used in the qPCR control experiments

Primer or Probe name

Sequence (5'→3')

Length

A5'Dye

ORF number in N315


HU

SA1305

F_HU_34

CAAAGAGAAAACATGGTTACCATTATTAA

29

R_HU_135

CTCAAGCACCTCATAAGGATTATCAG

26

P_HU_83A

AAAAGCCTATGGAAATTGCCCTCGCA

26

FAM

agrA

SA1844

F_agrA_34

CAAAGAGAAAACATGGTTACCATTATTAA

29

R_agrA_135

CTCAAGCACCTCATAAGGATTATCAG

26

P_agrA_83A

AAAAGCCTATGGAAATTGCCCTCGCA

26

FAM

sarS

SA0108

F_sarS_553

CACCATAAATACCCTCAAACTGTTAGAG

28

R_sarS_638

TCATCTTCAGTTGAGCGTTCTTTT

24

P_sarS_596B

AAAAGCAAGGCTATCTAA

18

FAM

lytM

SA0265

F_lytM_32

CGATGGGCTTCGCTACATTT

20

R_lytM_105

ATGTGCTTGTTGGGTGTTTGTC

22

P_lytM_56A

TGGCGCATCAAGCAGATGCAGC

22

FAM

sodA

SA1382

F_sodA_168

TGTTGCTAATTTAGACAGTGTACCAGCTA

29

R_sodA_275

TCCCAGAATAATGAATGGTTTAAATG

26

P_sodA_198A

CATCCAAACTGCTGTACGTAATAATGGCGG

30

FAM

sirA

SA0111

F_sirA_151

GGGAAACCAAAGCGTGTTGT

20

R_sirA_246

TGTCCATGATTCTACAGCACCTACA

25

P_sirA_198A

ATATCAAGGTGCCACTGACGTCGCTGT

27

FAM


A Taqman probes with a 3'-TAMRA quencher (Eurogentec, Seraing, Belgium).

B Minor groove binder probe with non-fluorescent quencher bound to the 3'end (Applied Biosystems). All experiments used concentrations of 200 nM and 100 nM for primers and probes, respectively. Primers and probe for hla quantification have been published previously [87,88].

Garzoni et al. BMC Genomics 2007 8:171   doi:10.1186/1471-2164-8-171

Open Data