Figure 2.

Using web interfaces to identify chimeric EST sequences and clusters. Panel A. When the user clicks the Reverse Complement menu item displayed when the Detailed Data link in the Putative Sequence Control Panel is selected, a reverse complement view will be shown. COLD1_10_H04.b1_A029 is a 3'-end sequence with a verified 5' terminus in NS (or 3' terminus in SS in reverse complementary view) and "double-termini adapters". Its 5' counterpart, COLD1_10_H04.g1_A029, also has "double-termini adapters" and a detectable polyA tail. Panel B. Like Putative Sequence Control Panel, Verified Sequence Control Panel provides users many options for customizing their sequence views but focuses on verified features. For a given sequence, checking the Final Sequence box within the Verified Sequence Control Panel and then clicking Redraw Graph button, highlights with a red background the final sequence, which can then be directed to other search tools or cut-and-pasted into other applications. RTNACL1_14_G12.g1_A029 is a 5'-end sequence without any verified terminus. The last 28 bases (i.e., AAATAAATGGCGACTGTATGTGGACGAC, the bases with black background) of its final sequence have been manually highlighted with the cursor for illustration purpose. Panel C. Clicking the Gene Index menu item displayed when the Data Integration link in Putative/Verified Sequence Control Panel is selected, pops-up the relevant Gene Index cluster view. As shown, all three above-mentioned sequences are found in cluster TC65773, where COLD1_10_H04.g1_A029 is labelled as "5a", COLD1_10_H04.b1_A029 as "5b", and RTNACL_14_G12.g1_A029 as "8" within the cluster alignment graph. To verify the alignment, we found the last 28 bases of RTNACL1_14_G12.g1_A029 were located from 867 to 894 in COLD1_10_H04.b1_A029 (reverse complement) and from 635 to 662 in COLD1_10_H04.g1_A029. It appears that the whole cluster obtains about 300 extra bases in its 3' end because of the double-termini adapters. Panel D. By clicking the ORF menu item available after the Data Integration link in Putative/Verified Sequence Control Panel is selected, the final sequence for a given sequence read will be dynamically sent out for open reading frame detection. As shown, RTNACL1_14_G12.g1_A029 displays 6-frame ORF results. If available, the user can follow the InterproScan menu item that appears when the Data Integration link is selected to explore relevant protein signatures of the InterPro member databases.

Liang et al. BMC Genomics 2007 8:134   doi:10.1186/1471-2164-8-134
Download authors' original image