Table 5

Conditions used for PCR amplification of E. coli FRIK 920 genomic regions

Region

Primer Sequences

Ta, °C


S-loop#14, OI#7

ECs0236: 5'ggtaataccggcagacagaacatgg3'

68

ECs0244: 5'gtagcgcagaactccatattctcc3'

S-loop#16, OI#8

NA

S-loop#69, OI#45

ECs1160 (upstream): 5' ccgcctgcgatggtggttgc 3'

60.2

ECs1252: 5' gggcgcgggtgattttgctctc 3'

S-loop#72, OI#43/48

ECs1374: 5' aaatgagacgccagcacctatcca 3'

68

ECs1395: 5' aagcgagtaaggcagggaggagag 3'

S-loop#78, OI#51

ECs1575: 5'taaccacgctaccagtagccagaag 3'

68

ECs1601: 5' gctactacctgcatcgtgccagtat 3'

S-loop#83, OI#55

ECs1688 : 5'caccagtgcctgccagtcaatatct3'

52

ECs1707: 5'atgtcaacgacgcctctggatatgc3'

S-loop#85, OI#71

NA

S-loop#91/92/93

ECs1927: 5' tgcctcccgcccaactcacg 3'

60

ECs1958: 5' tagtcatcccccgccccacataac 3'

S-loop#153, OI#93

NA

S-loop#286, OI#172

ECs5240: 5' ggcacgccgatttccgacaa 3'

68

ECs5253: 5' aagcaaccgcccccgacatc 3'

KI#71

b1142: 5' aactggtaccgccaagactacac3'

ND

b1156: 5' ccgatactgaagcacagcatagc3'

KI#121

b2360: 5' taatatgcgtgccgtcagtgtgc3'

ND

b2363: 5' ctgccagatgatccaaccgagag3'

b1518-20 (backbone)

b1520/Z2184: 5' gttctacgctggtggaccgtatc3'

68

b1518/Z2187: 5' agatgaagacgcagtggcgttcc3'


Zhang et al. BMC Genomics 2007 8:121   doi:10.1186/1471-2164-8-121

Open Data