Table 2

Primer sets used in Q-PCR analysis.

Candidate

Affymetrix probe set

Acquisition temperature

Sense

Antisense

Product size (bp)


Sequence

Sequence

ASY1

Ta.9186.1.S1_at

83

AGGACTCCCACAAGCAATCG

ACCTGCTGGAGGATCGGCTC

159

DMC1

Ta.30833.1.S1_at

80

GCTGAGGAAAGGCAAAGGCG

CGGTGCAGTAGCCTTTGTCGATTT

195

MSH4

Ta.25861.1.A1_at

83

CTGAAGGATGGTGTCCGACG

AGGTCCTGCAATGCTTCACG

252

MSH6

Ta.24096.1.S1_at

80

CATAATATTGGCACAGATTGGAG

CTGACGAAAGCACGGAAGC

161

PHS1

TaAffx.47591.1.S1_at

80

TGATGCTGCTGGTGGAAATTCG

CGGACACTAGGCATGATAGGCG

270

RAD51B

Ta.7197.1.A1_at

81

CTGCCTGGCTGAAGCTGAAG

GATAGAACAAGCAAACTATGGGAG

267

RAD51C

Ta.10540.1.S1_at

79

TATTGATACAGAGGGCAGTTTC

AGCTGCATATTCGGAAGTAG

173

RAD54

Ta.7706.1.S1_at

82

GCTGTCGCAAACCCTTTCG

GTCGTAGGCACCAATCATCCATC

344

RPA

Ta.6986.1.S1_at

83

GAATGTCTTCCGTGAACCG

CATCTAAGGACGGGTGCTAG

274

WM5

Ta.25342.1.S1_at

81

CATCGAGTGGGCTTTAGCTATAG

CAACACGTAGTACGATAGATCCAAG

178

WMC3*

Ta.28776.1.A1_at

79

CGACCGACGGAATTGATATG

CTGTGAGAAGTTTCAGCATTATC

171

WMC4

Ta.30383.1.A1_at

80

GATTCCCAAATGTTCGAC

CAAATTGTCCTCCTTACG

266

WMC5

Ta.3224.2.S1_at

81

CTTGCTGCTCCCAATGATAATTC

CAGTTAGCTGCCAGGTCATCTTTC

245

WMC6

Ta.3385.1.A1_at

80

CGGACAGTCCAGATGTGC

CTATGCTTGCTGCCTGATG

271

WMC10*

TaAffx.38162.1.S1_at

79

AGGAGTTGACATGACAAGATTAGGGAGG

GCCACTTCACATGCACCCATCTAATC

166

Controls

Cyclophilin

82

CAAGCCGCTGCACTACAAGG

AGGGGACGGTGCAGATGAA

227

EFA1

82

CAGATTGGCAACGGCTACG

CGGACAGCAAAACGACCAAG

227

GAPdH

78

TTCAACATCATTCCAAGCAGCA

CGTAACCCAAAATGCCCTTG

220

Actin

77

GACAATGGAACCGGAATGGTC

GTGTGATGCCAGATTTTCTCCAT

236

Flat gene 1

Ta.9657.1.S1_at

83

CCCTCAGACCGCTGGCAA

GAGGCGGACAGACATGGAAGAA

300

Flat gene 2

Ta.28350.1.S1_a_at

80

ACGCAGCTACCTGTATCATTCGGATC

GAAGCGACGATGTCCACATGACC

160


Primer sets used and the product sizes obtained in addition to the acquisition temperatures used. Control genes in italics were those selected by geNorm for normalisation.

* indicates those transcripts that have an unclear orientation (not known whether sense or antisense).

Crismani et al. BMC Genomics 2006 7:267   doi:10.1186/1471-2164-7-267

Open Data