Table 1

Primers for PCR of AnoACE genes

Gene

Forward Primer sequence (5'-3')

Reverse Primer Sequence (5'-3')

Predicted Product Size From Genomic DNA(bp)


AnoACE1

GGAATGCATCGTGTGTGTTC

TACTCGAAGGGAATGGTTGG

943

AnoACE2

GGTACCGATCAACCAGTGCT

AAATCGCATCGACAAGCTCT

440

AnoACE3

CCCTGTGCAAGTGCTGATAA

ATACGGAACGCCATTGGATA

214

AnoACE4

CAGCCGAGATGCTGAAGAGT

GAACTCGCGCAACCTATACC

328

AnoACE5

TTGCTGCAGCGAATGCTAT

CACACCAGCCCAATCTTGT

754

AnoACE6

CAGCGAATGCTGTGTTCCT

CAATGTTGCCCCACTTCTGT

748

AnoACE7

CGCAGTGGAACTTTGAGACA

GTCTATTCGGCGCATTTGAT

782

AnoACE8

GGTCTGGGCGATACCAAGTA

CGCGTCAAATCGGAGTTAAT

220

AnoACE9

GCACACGTATCGGAAAATGA

GCGCTTCTCGATGAACTACC

803


Burnham et al. BMC Genomics 2005 6:172   doi:10.1186/1471-2164-6-172

Open Data