Table 8

EST loci used in a population-level PCR amplification screen in A. ordinarium

Locus ID

Forward Primer 5' to 3'

Reverse Primer 5' to 3'


1F8

AAGAAGGTCGGGATTGTGGGTAA

CAGCCTTCCTCTTCATCTTTGTCTTG

1H3

GGCAAATGCTGGTCCCAACACAAA

GGACAACACTGCCAAATACCACAT

2C8

GCAAGCACCAGCCACATAAAG

GGCCACCATAACCACTCTGCT

3B10

TCAAAACGAATAAGGGAAGAGCGACTG

TTGCCCCCATAATAAGCCATCCATC

5E7

ACGCTTCGCTGGGGTTGACAT

CGGTAGGATTTCTGGTAGCGAGCAC

5F4

CCGAGATGAGATTTATAGAAGGAC

TAGGGGAAGTTAAACATAGATAGAA

6A3

GTTTATGAAGGCGAGAGGGCTATGACCA

ATCTTGTTCTCCTCGCCAGTGCTCTTGT

6B1

TGATGCTGGCGAGTACAAACCCCCTTCT

TTTACCATTCCTTCCCTTCGGCAGCACA

6B3

ACCACGTGCTGTCTTCCCATCCAT

ACGAAGCTCATTGTAGAAGGTGTG

6B4

CCCACGATGAATTGGAATTGGACAT

CTGCCTGCCAGACCTACAGACTATCGT

6C4

ATGGCGCCAAAGTGATGAGTA

GGGCCAGGCACACGACCACAAT

6D2

ATCAAGGCTGGCATGGTGGTCA

GGGGGTCGTTCTTGCTGTCA

6H8

GAAGAAGACAGAAACGCAGGAGAAAAAC

CGGGCGGGGGCGGGTCACAGTAAAAC

BL005B_A01.5.1

GACAGGTCATGAACTTTTGAAAATAA

AAAGTATATGTACCAAATGGGAGAGC

BL006A_G07.5.1

GATGTCCTCTCCACTATACAAGTGTG

GTTTGACTTGTCACCACTTTATCAAC

BL012D_F02.5.1

ACAGCCAGAAATAGAAACTTTGAACT

TGAAAGTATGTATTGTTTTCACAGGG

BL013C_E01.5.1

AGGATGAAATAATATGCTGTGCTTC

ACCGTGATAAACTCCATCCCTT

BL014D_B11.5.1

AGCAAAACTCCTCTATGAATCTCG

ATTGCACACTAAATAGGTGAATACGA

BL279A_G10.5.1

ATGGCAGGATGAAGAAAGACAT

ATGCACTTTGGACCCACTGAG

Et.fasta.Contig1023.5.1

TGTGGTTATTGGACTACTTCACTCTC

AAACGTCCATTTGACACTGTATTTTA

Et.fasta.Contig1166.5.1

GAATGAAGAGAAAATGTTTTGAAGGT

GCACAGTATTGGCTATGAGCAC

Et.fasta.Contig1311.5.1

AGAAAACTGTGTCAAGCTTATTTTCC

CAACTTAGTGTTCACATTTCTGAGGT

Et.fasta.Contig1335.5.1

CCACTTATGGTAGTTCCCACTTTTAT

GCTAAAGAATACCAAGAACCTTTGAC

Et.fasta.Contig1381.5.1

GTCACAGGTATAACATTGAAAGGATG

TAAATGAATCAAACATTGAAGAGAGC

Et.fasta.Contig1459.5.1

ATAACAAGGACATGTTCTGCTGG

CTAGCAGAACCCTGTATAGCCTG

Et.fasta.Contig1506.5.1

AGGATATCCGCTCAGAAATATGAAG

CTGACCACTTGCAAAACTTACTACCT

Et.fasta.Contig1578.5.1

CCTAGAACATTACCAAAACAGACTCA

AATGAAGAAGTATTGCATGTGAGAAC

Et.fasta.Contig1647.5.1

GTACAACGTCAGGCAAAGCTATTCT

ATCTCCAACACCGTGGCTAAT

Et.fasta.Contig1717.5.1

GAACTTGTTGGCAGGTTTCTCTT

CTAGTGATAGGTTGGACATACCAGAG

Et.fasta.Contig1796.5.1

TGTGGGTATGTATATGGCTAACTTGT

AGATTTTATGTGCTACTGCATTTACG

Et.fasta.Contig1908.5.1

CTCATGACTTAATTGCTGTTCTTCG

ATAACCATTCTGAGGTTTTGAGTTG

Et.fasta.Contig1941.5.1

ATCTCCTGCTTCATCTCTTGATTTAT

TAACAGATTTAATAAACGTCCCCTTC

Et.fasta.Contig1943.5.1

AGTACGATGAATCTGGTCCTTCAAT

CCACAATACTGACATACTCTGGTCTT

Et.fasta.Contig325.5.1

GTGAAGTCAGTGAGTAAAGTCCATGT

CTAGGATACCAGTGGGAGAGTGTAAT

Et.fasta.Contig330.5.1

GTCATCACCTCCACTACTTCACAAG

TTTTGGCACTGTAAGATTCTATGAAC

Et.fasta.Contig536.5.1

CCTTAGGTAGAACAGACTGAAGCAG

GAAACATGAAACTGGACTTGTTTTAG

Et.fasta.Contig917.5.1

GGATGCAGATTCTTCCTATTTTACTC

CTGGTCACTTTACTTGTTTTCAGTGT

Et.fasta.Contig926.5.1

TTCATCACATTCTACTTCACAAATCA

CTAGGCAAGCAAGCTTTCTAATAGTT

Et.fasta.Contig93.5.1

GAATAAAAGCAACAATTGCAGAGTTA

CTCGACTCCTTCTACGATCTCTACTC

Et.fasta.Contig990.5.1

GTTTAGGTTAGTATGAAGGATCCCAA

TGCCAGTACTCACCAATTAGTAAAAG

G1-C12

CCCAAATCCAGGAGTTCAAA

TGGGACCTGGGGCTTCATT

G1-C13

TTGCCCGAGAAAAGGAAGGACATA

CAAGGGTGGGTGAGGGACATC

G1-C5

F-CACTGTTGACTTGGGTTATGTTATT

CTGCTCCTAGGGTTTGTGAAG

G1-C7

CCCGTGTGGCTGGCTTGTGC

TCGGCTACTTTGGTGTTTTTCTCCCTCAT

G1-C9

TGGTCCGGCAACAGCATCAGA

GCTTTTCGGTATTCAACGGCAGAGTG

G1-C9

TGGTCCGGCAACAGCATCAGA

GCTTTTCGGTATTCAACGGCAGAGTG

G1-D5

AGACCCTTGCTGTGTAACTGCT

GACTGGGACTGACTTCTATGACG

G1-D6

CAGCGTGCCCACCCGATAGAA

TCCCAAAAAGTAAAATGTGCAAAGAAAA

G1-D7

CAGCGGTGGAAATGACAAACAGG

CCAAGACGACGAGGAACGGTATT

G1-E12

CAACCATGAGAGGAGGCCAGAGAAC

AAAACAGCACTACCTACAAAACCCTATT

G1-F1

TTAGTTTGGGTGCAGACAGGA

GGTGCTCAACAACAAATCAACT

G1-F20

TCCCCAACAACTCCAGCAGAT

GGAAACCACCTAGACGAAAAATG

G1-I18

CATGTTTGTGGGTGTGGTGAA

AAAAGCGGCATCTGGTAAGG

G1-I19

ACCCAGACCTGTCCACCTCA

GAACAGCTCTCCAATCCACAAG

G1-I21

CCAAGCGAAGGAGGCGTGTG

CATGTGGCTCTTTGTTTCTGGA

G1-I5

TAATCGTGTTTGGTGGCATCCTTGAGTC

AGCAGCAGTTCCATTTTCCCACACCA

G1-I8

ACCTGCAGTGGGCTAAGACC

ATGGAAATAATAAAATAAAATGTT

G1-J10

CGTTCGCTTTGCCTGCCACA

GGCTCTTCCCCGGTCGTCCAC

G1-J17

AGCGCCTTCTACACGGACAC

TATGCCCCAATTACTCTTCTGC

G1-J2

TACAGTAACTATGCCAAGATGAAATG

CAATATGGATAATGGCTGTAGACC

G1-J20

ATCCTCCAAGCTCACTACAACA

CCAGCCCCTTCCCAAACAG

G1-J9

CTGTCATTGCCTGCATCGGGGAGAAG

TGTTGAGGGGAAGCAGTTTTG

G1-K2

GCTTTCGCCTTTGACACCTC

GGCCGGACCATTGCTGAAGAAG

G1-L11

AAAGTGACCATCCAGTGCCCAAACCT

CCGGCCGAAACTGACGAGATACATTAG

G1-L13

TCAGCTGCACTAGGTTTGTC

CATTTTGATTTGCTCCATAA

G1-L19

GACAACCTTGAATCCTTTATG

AGATGTTGGTTGGTGACTTAT

G1-L20

TGGGCATAGATGGCAAGGAAAAA

CCCCCAGCATCTCGCATACAC

G1-L7

GTGCTACAGGAAGGAATGGATG

TAGCACAGGAACAGCCGACAATAA

G1-M14

CCGCTTGGACATGAGGAGAT

TGGCAAAGAAACAGAACACAACTA

G1-M19

GAGAAGTAGTGTCCCGGCAGAAAC

ATGGGTGAAAACTTAGGTGAAATG

G1-N9

GCGGGGCAATACATGACGTTCCACAG

GACCCCCATCTCCGTTTCCCATTCC

G1-O1

GGGGTAGAGCACAGTCCAGTT

TTGCAAGGCCGAAAAGGTG

G1-O12

GGAATTCCGGGGCACTACT

TCGCGAGGACGGGGAAGAG

G1-O24

CGGCCTTCCTGCAGTACAACCATC

TCGGCAACGTGAAGACCATA

G2-A11

GCCCCTGGAAGCTGTTGTGA

GGGGTCCATCCGAGTCC

G2-A7

TTACCCCACAGACAAAATCAACACC

GGCGGCCCCTCATAGCAC

G2-B1

GGGCCTAGTCCTGCTGGTC

CAAAGAGTGCGGAGAAATGG

G2-B8

CAACATGCGACCACTATAGCCACTTCCT

CGCCACCGCCACCACCACA

G2-C2

TTTGCAGGAAGAGTCATAACACAG

GTCAACAACACCCTTTTCCCTTCCT

G2-D1

GCAGGTCGGCAAGAAGCTAAAGAAGGAA

AGGGTTGGTTTGAAAGGATGTGCTGGTAA

G2-E17

GGAGCACCAAATTCAAGTCAG

CGTCCCCGGTCAATCTCCAC

G2-E19

CCAGTTTGAGCCCCAGGAG

TCGCGGCAGTCAAGAGGTC

G2-F17

TATCCTCTTATTGCTGCATTCTCCTCAC

AGTACGGCCGTTCACCATCTCTG

G2-F2

CACACCACAGACGCATTGAC

TCCCCAGCCTGTGTAGAAC

G2-G13

GGGAGGGGAGAAGGCTACCA

ATACACGGCTTCCATGCTTCTTCTT

G2-G15

CCACGGCCCCACATCCAGC

TCCCGCAGAATTTCCGTATCCAT

G2-G21

TCCAAGAGGGTGTGAGGTGAAC

AAAGCCATGCGAAGCGGAAGAC

G2-G23

GGTTTGGTACTTCAGCGGATGT

CCAAAGCCTGTACTATGCGAAAAG

G2-G5

CGGTCCCTACTGTGGTCTATGGTTTTCA

GGCTCTGCATATCCTCGGTCACACTTCC

G2-G6

CCCATGGCTGCAAGGATTACG

CAGGGGTTGTTGGGAGGCAGTGT

G2-H18

TTGTCAAATGGGCGAGTTCA

TGTTTTGCACCCAGTTTTTG

G2-I18

GATCTCCTCAGGTCTCTTTCA

GATTATGGGCCGGTGTCTCT

G2-I23

TGACTTTCCCAATGTGAGCAGAC

CAGAGGTGGTGTTACAGCAGCAGTTT

G2-J12

CCTCTTGTCCCAGTGCCAGTG

TCCAGGGATCCGAAACAAAG

G2-J21

CCGCCTCAGCCTGTTTCTCTACTTTT

CTTTGAATTTCTGCTTTTGGTGCTCTGC

G2-K12

ACATTAGTCCTGGTTACGAGAGC

AAAGGGCAGTCCAGCATTGA

G2-K2

CTGCCCAAGAAGACCGAGAGCCACAAG

AGCGCCCCCTGCACCAAAATCA

G2-L16

CCAAGGGTAGGAGAACAAGACA

ATGGCATGCTGGGAAATCA

G2-L21

GAATCTAGGTCCAAGCAGTCCCATCT

GACCATCACACCACTACCCACACTCA

G2-L3

TGAAAGAGGCCAGAAACAAGTAG

TTCCCAAGGTCTCCATAACAAT

G2-L4

TGGCCAAGAAGATGAAACAGGAAGAGGAG

TGGCAAAGGACACGACGCAGAG

G2-M14

CGGCCTCCTCGACGCATACG

CCAGGCCGGCCCATTGTTC

G2-M24

ACGGAGCACGGTCAGATTTCACG

CCCGGCTGGCTCTTCTTGCTCTT

G2-M3

CGATCCGCATTGAACGAGT

TGTGGCAGGAAGGAGAAGG

G2-N2

CGTGTTTTCCTCCTATGTCGACTTCTTTG

ACGTGCTCTGCCTTTCTTGATCTTGTGTT

G3-D7

AGGATTTCTTGGCCGGTGGAGTGG

GAAGTTGAGGGCCTGGGTGGGGAAGTA

NT001D_E08.5.1

AGAAGTTCCTAGATGAGTTGGAGGAG

AATTAATTTCCTAAACCAGGTGACAG

NT010B_E09.5.1

GAAGAGGTCCTAAAATATCAAGATGC

ATGATAGACTTCGTCCTTGTCATAGA

NT014D_E01.5.1

AAAGAAGTCCCGCATCTAACCT

ATTAAATATGAGAAGATGTGTGCAGG

V2_p1_b8

AGTCACTGTGTTACATTATCACCCAC

ATAATTATACACTGCGGTCTGCATCT

V2_p1_c5

AGTACCTGTTCGACAAGCACAC

TGAGAACATAGACAAGTTAACATACACC

V2_p1_d10

GAGATAGAAAGGCTGCATAAAGAAAT

TATGTTTCAACAATGTACAGGAAACC

V2_p1_d4

CACCAGAACAAGCTGTATTTTTATGT

TGGTTTGCATCATATATTAAAGGGTA

V2_p1_g7

GACTTCAAGCACATTGGGAAAC

ATTGTAAACTTGATAGGCTGGTGAG

V2_p2_g6

AGAATTCCCAATAGCACCTGAAAT

CACTTGGTAAATACATACACACAGCA

V2_p2_h2

CTTTTTGGCCTGGTCTTTTTG

AGATTCTTCAGACTCGTCCTTCTTT

V2_p3_a5

TTTACACAGAAACCTTGTTTATTTGGC

TTTAAGGATGCTTAGAGGCAAAGTATT

V2_p3_b1

AGTCACTGTGTTACATTATCACCCAC

TATACACTGCGGTCTGCATCTACT

V2_p5_b3

AATGGGATGAAGAGCGAGAAT

CTGCCCCATTGACATTTACCTA

V2_p5_h3

CCTTCAGACGAAAACAGCACTAAG

TACAGTGTATGAGAGCCCAATATTTC

V2_p6_a4

AGAAATACATCAAATATCGGGTGG

AAAAAGGACAATGTTCAGCTCTCT

V3_p1_a21

ACCAAGTTCTTGGAAAGTGGTG

CTTAGTGTCTCCTGGGTTTGAATAG

V3_p1_b13

GTCTTGGTACTCAATGAAGGAGATG

TCAATCTGATGAAGAGTTTACATGTCT


Putta et al. BMC Genomics 2004 5:54   doi:10.1186/1471-2164-5-54

Open Data