Table 1

DNA sequences

    Open Circle Probes

    Length

    Nucleotide Sequence


FV Normal

78 bases

5'-GCCTGTCCAGGGATCTGCTTCTTCGGTGCCCATCGCGCAGACACGATA GAGGAATACAACAAAATACCTGTATTCCTC-3'

FV WT-no hairpin

68 bases

5'-GCCTGTCCAGGGATCTGCTTCTTCGGTGCCCATCGCGCAGACACGATA ACAAAATACCTGTATTCCTC-3'

FV Mutant

78 bases

5'-GCCTGTCC AGGGATCTGCTCTGTTATCGGCCGTCGCGCAGACACGATA AAGGAATACAACAAAATACCTGTATTCCTT-3'

FV Mut-no hairpin

68 bases

5'-GCCTGTCCAGGGATCTGCTCTGTTATCGGCCGTCGCGCAGACACGATA ACAAAATACCTGTATTCCTT-3'

FII Normal

79 bases

5'-agcctcaatgctcccagtgcACAAGACCGAAAGGGTAGTCGCGGATTGTTG CGCTGAGAaataaaagtgactctcagcg-3'

FII Mutant

79 bases

5'-agcctcaatgctcccagtgcACTCAATCCCAGGCGAGTCGCGGATTGTTG TGCTGAGAGaataaaagtgactctcagca-3'

H63 Normal

99 bases

5'-ATCATAGAACACGAACAGCTGGTAGTATTGATCGGCCACTGGTATCTCGTCCG TGCTAGAAGGAAACATGAGAGTAGGCTCCACACGGCGACTCTCATG-3'

H63 WT-no hairpin

99 bases

5'-ATCATAGAACACGAACAGCTGGTAGTATTGATCGGCCACTGGTATCTCGTCCG TGCTAGAAGGAAATCAAGAGATGGGCTCCACACGGCGACTCTCATG-3'

H63 Mutant

99 bases

5'-ATCATAGAACACGAACAGCTGGTAATGTTGACTGGTCACACGTCGTATCGTCCG TGCTAGAAGGAAAGATGAGAGTCAGGCTCCACACGGCGACTCTCATC-3'

H63 Mut-no hairpin

99 bases

5'-ATCATAGAACACGAACAGCTGGTAGTATTGATCGGCCACTGGTATCTCGTCCG TGCTAGAAGGAAATCAAGAGATGGGCTCCACACGGCGACTCTCATC

C282 Normal

89 bases

5'-CCAGGTGGAGCACCCAGGTCAGTTATCGGGCCGAGGCGCGAGTGTAAA CACGTATATCTCTCCCCTGGGGAAGAGCAGAGATATACGTG-3'

C282 Mutant

90 bases

5'-CCAGGTGGAGCACCCAGGTTCTACCTCAGCCCGAAGGCGCGAGTGTAAA CACGTATATCTCTCCCCTGGGGAAGAGCAGAGATATACGTA-3'


    Primers

    Length

    Nucleotide Sequence


FV Normal P1

31 bases

5'-/56-FAM/ TCATTCGCAATCAATGGGCACCGAAGAAGCA-3'

FV Mutant P1

31 bases

5'-/5Cy3/TCATTCGCAATCAACGGCCGATAACAGAGCA-3'

FV P2

15 bases

5'-CGCGCA GACACGATA-3'

FV 5' allele specific primer

18 bases

5'-GAGGAATACAACAAAATA-3'

FV 3' allele specific primer

15 bases

5'-GATCCCTGGACAGGC-3'

FII Normal P1

28 bases

5'-/56-FAM/ TCATTCGCAATCACCCTTTCGGTCTTGT-3'

FII Mutant P1

28 bases

5'-/5Cy3/ TCATTCGCAATCACGCCTGGGATTGAGT-3'

FII P2

15 bases

5'-AGTCGCGGATTGTTG-3'

FII 5' allele specific primer

15 bases

5'-CACTGGGAGCATTGA-3'

H63 Normal P1

29 bases

5'-/56-FAM/ TCATTCGCAATCAGATACCAGTGGCCGAT-3'

H63D Mutant P1

27 bases

5'-/5Cy3/ TCATTCGCAATCAACGACGTGTGACCA-3'

H63 P2

18 bases

5'-GTCCGTGCTAGAAGGAAA-3'

H63 5' allele specific primer

17 bases

5'-TGTTCGTGTTCTATGAT-3'

H63 3' allele specific primer

15 bases

5'-GGCTCCACACGGCGA-3'

C282 Normal P1

28 bases

5'-/56-FAM/ TCATTCGCAATCACGGCCCGATAACTGA-3'

C282Y Mutant P1

28 bases

5'-/5Cy3/ TCATTCGCAATCA CGGGCTGAGGTAGAA-3'

C282 P2

15 bases

5'-AGGCGCGAGTGTAAA-3'

C282 5' allele specific primer

15 bases

5'-GGGTGCTCCACCTGG-3'

C282 3' allele specific primer

14 bases

5'-GCAGAGATATACGT-3'


Alsmadi et al. BMC Genomics 2003 4:21   doi:10.1186/1471-2164-4-21

Open Data