Table I

Sequence of oligonucleotides used in the study.

Oligonucleotide

Sequence


OCP-1822inC

5'GAAGAACTGGACAGATTTACTACGTGACTCGTCATGTCTCAGCTCTAGTA

CGCTGATCTTAGTGTCAGGATACGGAGATGTTCTGCTTTGTC

OCP-1822ocT

5'GAAGAACTGGACAGATTTACTACGTATGTTGACTGGTCACACGTCGTTCT

AGTACGCTTCTACTCCCTCTTGAGATGTTCTGCTTTGTT

P1-1822inC-

5'FAM-TCGATGACTGACGGTCATCG(DABCYL-dT)ACTAGAGCTGAGACA

FAM

TGACGAGTC

P1-1822ocT-

5'TET-TCGATGACTGACGGTCATCG(DABCYL-dT)ACGACGTGTGACCAG

TET

TCAACAT

P2-1822inC

5'aba-aba-GATACGGAGATGTTCTGCTTTGTC

P2-1822ocT

5'aba-aba-CCTCTTGAGATGTTCTGCTTTGTT

OCP-1822C

5'GAAGAACTGGACAGATTTACTACGTATTCTGACTCGTCATGTCTCAGCTT

TAGTTTAATACGACTCACATATCCCAGATGTTCTGCTTTGTC

OCP-1822T

5'GAAGAACTGGACAGATTTACTACGTATTCTGACTCGTCATGTCTCAGCTT

TAGTTTAATACGACTCACTATAGGGAGATGTTCTGCTTTGTT

P2-1822C-

5'TET-TCGATGACTGACGGTCATCG(DABCYL-dT)ATATCCCAGATGTTC

TET

TGCTTTGTC

P2-1822T-

5'FAM-TCGATGACTGACGGTCATCG(DABCYL-dT)TATAGGGAGATGTTC

FAM

TGCTTTGTT

P1

5'aba-aba-CTAAAGCTGAGACATGACGAGTC

Oligonucleotides used in the studies of ligation

kinetics, affect of OCP 3' arm length, and ligation

temperature

CFTR M1101K

5'CTTGTACCTGTCAACACTGCGCTGGTTCCAAAXGAGAATAGAAATGATTT

target

T TGTCATCTT

x = T in wild type and A in mutant

OCP-M1101K23

5'TTTGGAACCAGCGCAGTGTTGACACTCTGACTCGTCATGTCTCAGCTTTA

GTTTAATACGACTCACTATAGGGGACAAAAATCATTTCTATTCTCY

OCP-M1101K20

5'TTTGGAACCAGCGCAGTGTTGACACTCTGACTCGTCATGTCTCAGCTTTA

GTTTAATACGACTCACTATAGGGAAAAATCATTTCTATTCTCY

OCP-M1101K15

5'TTTGGAACCAGCGCAGTGTTGACACTCTGACTCGTCATGTCTCAGCTTTA

GTTTAATACGACTCACTATAGGGTCATTTCTATTCTCY

OCP-M1101K23

5'TTTGGAACCAGCGCAGTGTTGACACTCTGACTCGTCATGTCTCAGCTTTAG

TTTAATACGACTCACTATAGGGTTTCTATTCTCY

Y = A in wild type and T in mutant. The number 12,

15, 20 or 23 refers to the number of base pairs the

3' end forms with the target.


Faruqi et al. BMC Genomics 2001 2:4   doi:10.1186/1471-2164-2-4

Open Data