Table 1

PCR primers and conditions for CoBRA analysis
IAP Clade Position Forward primer Reverse primer Nearest gene Distance Cycles Temperature (°C)
CabpIAP 1 (red) chr2:154179911-154180159 ATTATTTTTTGATTGGTTGTAGTTTATGG CACCAACATACAATTAACA Cdk5rap1 intron 39 47
iap31 1 (red) chr1:89356306-89357454 TAAGAAGTAAGAGAGAGAAGTAA CCAAACAAATCCAAAAACCTAA - - 45 52
iap44 1 (red) chr10:77413077-77414228 GGTTAGGAAGAATATAATAATTAG CTAAAAATAAAACCCAAAAACCC Trpm2 Intron 45 52
iap51 1 (red) chr12:53835543-53836696 GGGAAAAATAGAGTATAAGTAG TCTAACAACTACCCACAAAAAAT Akap6 Intron 40 52
iap77 1 (red) chr17:64098002-64099153 AAGTAAGAGAGAGAGAAAAT TATAACCCCCAAATAACTAACAT - - 45 52
iap90 1 (red) chr18:47812857-47814008 GGGAAAAATAGAGTATAAGY CACTAAAAACAACAATCTAACAAC Gm5095 Intron 43 52
iap110 1 (red) chr2:72112889-72114056 AAGTAAGAGAGAGTAAGAAGTAA CATATACAACACTTAAAACAAAACC Rapgef4 18 kb upstream 45 52
iap176 2 (green) chr1:127212941-127214106 TTTATATTTTTGGGAGTTAGG AACACTCTTCTACAATAACATCT - - 40 52
iap182 2 (green) chr1:26288894-26290059 TGTTTATATTTTTGGGAGTTAG AACCTACTTCATCTTAAAAC - - 45 52
iap186 2 (green) chr10:24567718-24568883 GTATTATTTTTTGATTGGTTGTAG AAACCCACTAATTCTTCCTAT Enpp3 12 kb upstream 40 52
iap195 2 (green) chr12:25079835-25080998 TTGTTTATATTTTTGGGAGT CACCTTATATTCTCCAAAAAAAC - - 40 52
iap236 2 (green) chr4:155057154-155058318 GTATTATTTTTTGATTGGTTGTAG AATTTTTTTCCCCTTCAATC Mib2 15 kb upstream 45 52
iap268 2 (green) chr9:123106561-123107725 TTTATATTTTTGGGAGTTAGG ACACCTAACATCATCTAAAT Cdcp1 Intron 45 52
iap281y 2 (green) chrY:2136760-2137925 GGTTAGGAAGAATATTATAGA TACACCAAAAACAAACCAAA Rbmy1a1 8 kb downstream 45 52
iap506 3 (black) chr12:74416066-74417247 AGTAAGAAGTAAGAGAGTAAGAA CTACACCCCAAAAATAATAAAAAC Slc38a6 Intron 45 52
iap655 3 (black) chr15:11992027-11993248 AGAGAAAAGTAAGAGAGAGAAAA AAAACAAAAAAAACTACACCC - - 45 52
iap1112 3 (black) chr6:101092968-101094168 TAAGAGAGAGAGAAAAGTAAGAGA CCACCAAAATAAAAACTCAAAAC Pdzrn3 6 kb downstream 43 52
iap1248 3 (black) chr8:63849572-63850723 TTTTTAGGAGTTAGAGTGTA CTCCTTTCTAATTTTATTCTCCA Sh3rf1 Intron 45 53
iap1252 3 (black) chr8:47435363-47436559 AGAAAAAGTAAGAGAGAGAGAAA AACCCTAAAATTCCTCAAAAAAC Helt 56 kb upstream 40 54
iap1259 3 (black) chr8:8319882-8321071 AAGAAGTAAGAGAGTAAGAAGTAA ACAAAAAATCAACTAAACTCTAC - - 45 53
iap1334 3 (black) chr9:121236806-121238001 AAGTAAGAGAGAGAGAAAAGTAA RACTACTACTAAAAACCCACAA Trak1 Intron 40 54

Faulk et al.

Faulk et al. BMC Genomics 2013 14:48   doi:10.1186/1471-2164-14-48

Open Data