Table 3

The corresponding primers of qRT-PCR
Primer sequences Amplified genes
ACTAATTTGCACCGTGTT (S) Bra020899
GGTAGCGTTTCTGTAAGC (A)
GAAATCTTTGCTTATCCGCTAT (S) Bra011351
AAACGCTGAGGCACCTTG (A)
GTCAGATATTTCGGAAGC (S) Bra002935
CAAGAGTTGAGAACACCC (A)
GGCGATATTCTCAGTCCA (S) Bra018342
CACCTCCAAGTGAAACCC (A)
GCAGGAGGTGCATTAGCC (S) Bra040150
ACCCAGCAACAACGAAGC (A)
TGGCTGGGAACAGAACTT(S) Bra012531
AGGCTTTCCAGACTACGG (A)
GAAGTCAATGGGAAAGATG (S) Bra034363
ACTCGAACAGGCTGAAAC (A)
CTGTCTATTCTCCCTTCCC (S) Bra031708
AACGGTTTCCCATTGCTG (A)
AGTCATCGTCGCCGTTAT (S) Bra031854
AGGATTTGGTCGCAGTCA (A)
CGACGGATACAGCACAGG (S) Bra023103
ACGGCTTGGACTCGTTGTAGAT (A)
AAGCCTCGCCAAAGAAAC (S) Bra036557
TCAACGGCATGTGAAAGC (A)
TCTCCGTTACCATCAATA (S) Bra012583
TGTAGCCATGTCATCTTT (A)
GAATACGAACGGAGCAAGA (S) Bra039837
TGGTTTCCCACCATAAGC (A)
GCTACATACAAGGTCCAGTT (S) Bra040469
TAAGATAAGCCGCACAAG (A)
TGCTATCCAGGCTGTTCT (S) Actin of B. napus
TTAATGTCACGGACGATTT (A)

Yan et al.

Yan et al. BMC Genomics 2013 14:26   doi:10.1186/1471-2164-14-26

Open Data