Table 5

cDNA sequences obtained from F (fruits in November) and their homologous GenBank records
cDNA GenBank Accn No** Size (nt) GenBank record(s) with informing similarity E - Value Primer pairs used in qRT-PCR (All sequences are presented from 5’ to 3’. F: Forward, R: Reverse)
F46* F55* F57* GW574276 132014201450 At2g31770 zinc finger family protein (gi91806300), Arabidopsis thaliana IBR domain-containing protein / ARIADNE - like protein ARI7 mRNA 2e-60 0.0 2e-76 0.0 2e-66 0.0 F: CAGGAATCAAAAGAAAATATTCTGAAC
R: TCGACTCATAGACAAACTATGTACAGG
F4 F22 GW574277 12501240 Petunia x hybrida mRNA for triosephosphate isomerase 3e-81 0.0 F: CCTGGATTAACTTGTGCATTTATACTT
R: CATCTAAGCGAAGTTCCAAATAGATAC
F12* F20* GW574278 1440 Solanum tuberosum UDP-glucose 4-epimerase (StUGE45) mRNA 0.0 F: TATATTGCTGAGGTACTTCAATCCAG R: TGCTAAATCCACAACATGGATATAAT
F13 F17 GW574279 510 Digitalis lanata mRNA for Acyl-CoA binding protein (acbp4 gene) 4e-74 F: CAAGCTTGTTCTTTATGGACTTTACA R: CATGGATGAGTACTTAGTTATGCTGCT
F10* GW574280 3000 Arabidopsis thaliana nuclear-pore anchor 3e-14 F: GTCGTCTTCCCAAAATATAGAAACTC R: GGGTCTCTACACCTTTAGACTTTTTG
F51 GW574281 800 Multiple tRNA genes and PSII binding proteins (see Accn gi170785617) 0.0 F: CTTGAAATCCAATTCTAAAAGATCAAA R: ATAATAGAGGAATGGGGGTAGAGTAGA

* cDNAs that are new for olive.

** Obtained from GenBank for the sequences generated through this study.

Dündar et al.

Dündar et al. BMC Genomics 2013 14:219   doi:10.1186/1471-2164-14-219

Open Data