Table 4

cDNA sequences obtained from NN (non-fruited leaves in November) and their homologous GenBank records
cDNA GenBan Accn No** Size (nt) GenBank record(s) with informing similarity E - Value Primer pairs used in qRT-PCR (All sequences are presented from 5’ to 3’. F: Forward, R: Reverse)
NNF14* NNF36* NNF85* GW574267 1430 1360 1410 Arabidopsis thaliana zinc finger family protein (At2g31770), IBR domain -containing protein (gi91806300) 0.0 F: CAGGAATCAAAAGAAAATATTCTGAAC
R: TCGACTCATAGACAAACTATGTACAGG
NNF22* GW574269 1100 Vitis vinifera hypothetical protein mRNA (gi225450142) 2e-22 F: CAAATCTCTTCATCTTCTTCAATTCTG
R: CAGTATAAAAACTTGATTCCCTCCATA
NNF23* GW574270 1000 Lycopersicon esculentum temperature - induced lipocalin mRNA (gi77744858) 0.0 F: ATATAAGTCTGATCCCAATAGTGACGA
R: TTCTGTACAAGCATGTAGTGTATCTCC
NNF24* GW574271 1200 Nicotiana tabacum eIF4E (initiaition factor) mRNA (gi51599168) 1e-63 F: GAATGTCAGATTAAGGCAGGATAAA
R: AGCTTCTTAGCATCCTCATGAAATA
NNF29* GW574272 1670 Arabidopsis thaliana transducin family protein (At2g26490) mRNA (gi42569344) 1e-74 F: GGTTGTGTATAGTGGGAGTCTTGATA
R: ACTTTGATTTGATCAATACTTTGCTG
NNF31 GW574273 800 Plantago major cold stress-induced protein (src1 gene) mRNA (gi53748474) 7e-27 F: AAAAAGAAGAAAGACAAGAAAAAGCAT
R: ATACACAATCAAAGAGTAGCCAACAAC
Retama raetam drought-induced protein (DIP) mRNA (gi16198345) 1e-24
NNF32 GW574274 600 Multiple tRNA genes and PSII binding proteins (see Accn gi170785617) 0.0 F: CTTGAAATCCAATTCTAAAAGATCAAA
R: ATAATAGAGGAATGGGGGTAGAGTAGA
NNF59* GW574275 800 Arabidopsis thaliana PSRP4 (Plastid specific-ribosomal protein 4) mRNA (gi145360741) 3e-39 F: ATTCTCTCACATCAATCTCATCTCC
R: GTCCTCTTCCCTTATTCTTGTCCT
NNF91* GW574268 660 Arabidopsis thaliana pre-mRNA splicing factor (At4g14342) mRNA (gi145361320) 4e-56 F: TTCTATCGGGTGTATAATTTGATCTTT
R: TTATTAACCAAGTGGGTACAGATTCTT

* cDNAs that are new for olive.

** Obtained from GenBank for the sequences generated through this study.

Dündar et al.

Dündar et al. BMC Genomics 2013 14:219   doi:10.1186/1471-2164-14-219

Open Data