Table 2

cDNA sequences obtained from NF (non-fruited-leaves in July) and their homologous GenBank records
cDNA GenBank Accn No** Size (nt) GenBank record(s) with informing similarity E - Value Primer pairs used in qRT-PCR (All sequences are presented from 5’ to 3’. F: Forward, R: Reverse)
JNF1* GW574243 300 No signifcant match in any databank - F: AACTGACACAATTGCAAAGAGG
R: CACAGTCATTAATTAACAACCAAAGAA
JNF32* JNF87* GW574244 1900 No signifcant match in any databank - F: TCACTTCAATATACATGAAACAAAATCTC
R: AGATAACCAAGAAAAAGAAAGAAGGAG
JNF31 JNF48 JNF84 GW574245 1850 800 1830 Nicotiana tabacum cytochrome P450 monooxygenase (CYP72A56) mRNA (gi85068677) 6e-36 8e-33 5e-43 F: TTCTCGTTTGAGATTTCACCTACTTAT
R: AGAGAGAATGCATAACAACATACGATA
JNF42* JNF82* GW574246 1000 Lycopersicon esculentum ethylene responsive protein (ER6) (gi5669653) 1e-92 F: TGCTCTTCAAATTTGCTCTAATAAAA
R: TTTGAACAATAGTTGCTAACACTTCC
JNF2 JNF62 GW574247 900 Lycopersicon esculentum wound/stress protein (gi51457947) 1e-56 F:AGTGTACCCAGGTAAGTTTCACTGTAG
R: CAAAGTCCAACAACTCTACATTACAGA
JNF51 JNF55 GW574248 1210 1290 A gene complex of multiple tRNA genes and Photo System II binding proteins (see Accn gi170785617 at NCBI) 0.0 F: CTTGAAATCCAATTCTAAAAGATCAAA
R: ATAATAGAGGAATGGGGGTAGAGTAGA
JNF56 JNF65 GW574249 1120 1070 Arabidopsis thaliana putative ribosomal protein L10 (At1g08360) (gi21386914) 0.0 F: CAAAAACTATGATCCACAGAAGGATA
R: CTTAACCAGTTTCTTGTTTTTGTTCA
JNF4 GW574250 1000 Zea mays disease resistance response protein (gi100284658) 0.0 F: GGACATGTTGTTTTGGAATATACTCTT
R: CATAACAACCTAAAGATGAAAAGAACC
JNF79* GW574251 3000 C.roseus cpr mRNA for NADPH ferrihemoprotein reductase (gi18138) 0.0 F: TCAAACTTCCTGCTGATTCTAAAGT
R: AAAGTTGTTCAACTCATCCTCGTAG
JNF83* GW574252 900 Populus trichocarpa, unknown mRNA (gi18485578) 3e-25 F: GCGTAGTGACTAATCCTTGTCTACC
R: AAGTTGGTAAAAGACAAATTTCAACAT
JNF92 GW574253 1600 Solanum phureja DnaJ-like protein isoform (gi113374277) 1e-43 F: TGATTGAGATCAAACAAGCATACAG
R: ATGTCTAAATCGTACAACGCTCTCTT
JNF96* GW574254 1000 Arabidopsis thaliana ATHX (THIOREDOXIN X) mRNA (gi45336578) 1e-36 F: TTGAAAAATACAAGGTATATGGATTGC
R: TCTAAGTAACAGACACAGACCTCAGAA

* cDNAs that are new for olive.

** Obtained from GenBank for the sequences generated through this study.

Dündar et al.

Dündar et al. BMC Genomics 2013 14:219   doi:10.1186/1471-2164-14-219

Open Data