Table 1

cDNA sequences obtained from JF (fruited-leaves in July) and their homologous GenBank records
cDNA GenBankAccn No** Size (nt) GenBank record(s) with informing similarity E - Value Primer pairs used in qRT-PCR (All sequences are presented from 5’ to 3’. F: Forward, R: Reverse)
JF146 JF151 JF187 GW574236 180018201800 Nicotiana tabacum cytochrome P450 monooxygenase (CYP72A56) mRNA (gi85068677) 3e-33 8e-34 5e-36 F: TTCTCGTTTGAGATTTCACCTACTTAT
R: AGAGAGAATGCATAACAACATACGATA
JF124* JF150* GW574235 1500 Capsicum annuum menthone:neomenthol reductase 1 (MNR1) mRNA (gi123691540) 2e-81 F: GGAGTAAGTGTAGAGGGAGATGTCTTA
R: ACAACCTTAAGAGTGGAATAAATGCTT
JF111* JF148* GW574234 1000 Glycine max transcription factor (bZIP124) mRNA (gi113367217) 3e-52 F: ATCTCCTGGTGCATTTAATTATTGAT
R: ATCTCCTGGTGCATTTAATTATTGAT
JF154* JF160* GW574237 3000 Spinacia oleracea ClpC protease mRNA, chloroplast gene encoding chloroplast protein (gbAF043539) 0.0 F: TGTGTTAGAACTCTCACTAGAGGAAGC R: CACCATCTAATAACCTGTGTACGAAAT
JF45 GW574239 3000 O.europaea putative cytochrome P450 mRNA (gi154257296) 5e-20 F: GAGTACAAGGGACAACATTTTGAGTT R: AGTGGATTCTTCTTCCTCAAAGTTAAT
JF46* GW574240 550 Arnebia euchroma chloroplast protein 12 (CP12) mRNA (gi151564657) 2e-60 F: GTAGGATGTACGTCCACCCAGT
R: GTTGTCCTTGCAGTAATCTTCCA
JF126* GW574241 700 Arabidopsis thaliana integral membrane HRF1 family protein (At3g59500) (gi145339670) 1e-80 F: TGCAGTCAATTTTATTATTTTGTTTGA
R: TTTTCCAAATATATTAATGCCAGAACT
JF153* GW574242 1500 Arabidopsis thaliana emryo defective binding / small GTPase regulator (EMB2754) mRNA (gi78498847) 2e-28 F: TTTTATTGTCTGCATTTCTTCAGTTC
R: ATAAACAGAATTGTCCACCACTACAA
JF178 GW574238 3200

Raphanus sativus chloroplast mRNA for ATPase beta subunit (atpB gene) (gi8052351),

Olea europaea ATP synthase epsilon subunit (embCAD23950)

0.0 1e-31 F: AACTTTCTCAAGATTCTTATTCATCCA
R: ATAGCACGGAGATCAGTTAATTCAATA

* cDNAs that are new for olive.

** Obtained from GenBank for the sequences generated through this study.

Dündar et al.

Dündar et al. BMC Genomics 2013 14:219   doi:10.1186/1471-2164-14-219

Open Data