Table 4

Small RNAs with nucleotide lengths larger than 25 nt
smallRNA ID Sequence Length (nt) Hit in the piRNABank E-value
iso_smRNA1 CCCTCGGTTCTGGCGTCAAGCGGGCCGGC 29 No hit -
iso_smRNA2 GCATGTGGTTCAGTGGTAGAATTCTCG 27 hsa_piR_018570 0.0053
iso_smRNA3 GCATTGGTGGTTCAGTGGTAGAATTCTCGC 30 dr_piR_0029993 0.0000065
iso_smRNA4 GCATTGTGGTTCAGTGGTAGAATTCTCGCC 30 hsa_piR_018570 0.00065
iso_smRNA5 GCCCGGCTAGCTCAGTCGGTAGAGCATGA 29 hsa_piR_000794 0.000017
iso_smRNA6 GGGTTCGATTCCCGGTCAGGGAACCA 26 No hit -
iso_smRNA7 GGTTCCATGGTGTAATGGTTAGCACTCTG 29 hsa_piR_020582 0.000019
iso_smRNA8 GGTTCTATGGTGTAATGGTTAGCACTCTG 29 hsa_piR_020582 0.00011
iso_smRNA9 GTTGTCGTGGCCGAGTGGTTAAGGCAATG 29 hsa_piR_015249 0.0054
iso_smRNA10 GTTTCCGTAGTGTAGTGGTTATCACGTTCG 30 rno_piR_005901 0.0000065
iso_smRNA11 TCCCATATGGTCTAGCGGTTAGGATTCCT 29 dr_piR_0027014 0.018
iso_smRNA12 TCCCTGGTGGTCTAGTGGTTAGGATTCGGC 30 ona_piR_166322 0.0000065
iso_smRNA13 TCCCTGTGGTCTAGTGGTTAGGATTCGGCG 30 ona_piR_166322 0.00049
iso_smRNA14 TCCTCGTATAGTGGACAGTATCTCCGCC 28 No hit -
iso_smRNA15 TGAAAGACAACTCTTAGCGGTGGATC 26 No hit -
iso_smRNA16 TGCGACCTCAGATCAGACGAGACAACCC 28 dr_piR_0026826 0.0056
iso_smRNA17 TGGCTTCCTAAGCCAGGGATTGTGGG 26 No hit -

E-value smaller than 0.05 is shown here.

Kitano et al.

Kitano et al. BMC Genomics 2013 14:214   doi:10.1186/1471-2164-14-214

Open Data