Table 2

Sequence origins, homology and primer sequences of 24 Conserved Avian Microsatellite ( CAM ) loci
Marker Sequence origins: ZF: zebra finch contig name & position CH: chicken chromosome & base pair location* ZF seq. length (bp) and similarity to CH (E-value) Homology to ESTs or genes Ŧ Primer sequence (5- 3) and fluoro-label ¥ No. of degen. bases in primer pair Primer seq. similarity to CH (%ID) (& number of bases mis-matching) Ψ
CAM-01 ZF: Contig4.1379:6555-6992 437 Gene [F] [HEX]AAAGGCCAAG
    R
CCAGTATG
1 [F] 100
CH: chr2:67828480-67828907 9E-147 [R] CTCTCATCCACCCTGTTAGC [R] 100
CAM-02 ZF: Contig5.1371:163550-163981 431 None [F] [6FAM]GAATTAAAGA
    Y
AGCAGATGCAGG
1 [F] 100
CH: chr7:22132454-22132893 1.1E-96 [R] AGCTGATGAAATGAGAATGCAG [R] 100
CAM-03 ZF: Contig5.1597:35280-35767 487 None [F] [HEX]ATTAGCATAGCTCAGCATTGCC 1 [F] 91 (2)
CH: chr7:24391832-24392259 2.2E-70 [R] CGAGCATTCAA
    M
CCTGTCATC
[R] 95 (1)
CAM-04 ZF: Contig8.649:3118-3539 421 None [F] [6FAM]TACCTCTGGC
    Y
AAGGAACTG
1 [F] 90 (2)
CH: chr1:133721521-133721942 6E-133 [R] GCTCAGAACATCAATCACTGC [R] 100
CAM-05 ZF: Contig12.77:11232-11665 433 EST & gene [F] [6FAM]TTACACAGACTGCAAACCGC 1 [F] 100
CH: chr1:47660443-47660868 2.4E-72 [R] CTGTT
    K
CTCTAGTAATGAGATCCTG
[R] 92 (2)
CAM-06 ZF: Contig12.342:17413-17858 445 Gene [F] [HEX]GTGATGGTCCAGGTCTTGC 0 [F] 100
CH: chr1:52304006-52304445 9E-115 [R] CAAGAGGAACAGATGAGGGTC [R] 100
CAM-07 ZF: Contig12.442:2629-3062 433 EST & gene [F] [HEX]AAATGATGAG
    R
TCTGGGTGAG
2 [F] 100
CH: chr1:53412026-53412463 2E-113 [R] CCATTTCCAAG
    W
GATTTGC
[R] 100
CAM-08 ZF: Contig13.893:13419-13850 431 EST & gene [F] [6FAM]AGAA
    R
AAGCCACCCTCACAG
1 [F] 100
CH: chr10:516461-516890 5E-79 [R] CTCGTTTCCATTGGCGTTG [R] 95 (1)
CAM-09 ZF: Contig15.537:32597-33018 421 None [F] [HEX]AGA
    Y
ACACAGCCACCCCAGAG
3 [F] 86 (3)
CH: chr4:17039238-17039667 1.6E-79 [R] CAC
    W
TGTATCCACA
    Y
GCTGAC
[R] 90 (2)
CAM-10 ZF: Contig16.130:3866-4309 429 EST & gene [F] [6FAM]TATCC
    M
GAGAATGGGCATC
2 [F] 89 (2)
CH: chr13:1070809-1071238 4.4E-67 [R]
    K
GCTCTCATTGTCATGCTG
[R] 95 (1)
CAM-11 ZF: Contig17.242:5423-5868 445 EST & gene [F] [HEX]TGGTACAGGGACAGCAAACC 1 [F] 100
(Z-linked) CH: chrZ:7888318-7888739 1.7E-89 [R] AGATGCTG
    R
GAGCGGATG
[R] 100
CAM-12 ZF: Contig23.425:77718-78157 439 None [F] [6FAM]TGGCA
    R
TAA
    W
TCCAGAGATTACC
3 [F] 100
CH: chr2:62785492-62785919 1E-95 [R] CTG
    R
CATTTGTCTTAAGCGTG
[R] 95 (1)
CAM-13 ZF: Contig28.55:8348-8785 437 EST & gene [F] [HEX]TCAAATACAGCAGCAGGCAG 0 [F] 100
CH: chr6:28449965-28450408 4E-140 [R] TTCATTACCAAACAGCATCCAG [R] 100
CAM-14 ZF: Contig32.413:24503-24950 447 Gene [F] [6FAM]G
    Y
AAGTGAAAGCTAAAGAAAGCC
1 [F] 100
CH: chr9:5323789-5324214 2.3E-92 [R] GGCAGTTCCAGCCATTTAC [R] 100
CAM-15 ZF: Contig49.62:16781-17206 425 Gene [F] [6FAM]
    S
GACGACTCCTTTATTTCCC
2 [F] 90 (2)
CH: chr1:73032096-73032543 9E-105 [R] TTCTGACTTCC
    Y
CAGGTAACAC
[R] 100
CAM-16 ZF: Contig50.513:25871-26302 431 Gene [F] [HEX]AGCCTTGAT
    M
TTGGGAAGAGC
2 [F] 90 (2)
CH: chr17:4598995-4599424 1.1E-85 [R] ATCCATACTC
    Y
GTGCAACCTG
[R] 100
CAM-17 ZF: Contig56.179:11880-12303 423 EST [F] [6FAM]CGGGTTGTAATCAAGAAGATGC 0 [F] 100
CH: chr3:10551236-10551663 5E-141 [R] CTGCGGAGCAATTAACGC [R] 100
CAM-18 ZF: Contig61.97:37926-38358 432 EST & gene [F] [HEX]TTAAGAAGTTTACACCCAGCG 0 [F] 100
CH: chr3:31888225-31888655 1E-106 [R] GCTAAATAACAGAGCCAGGAAG [R] 100
CAM-19 ZF: Contig69.248:5308-5739 431 EST & gene [F] [6FAM]TCTTGGAGGCAGATA
    R
GAAGTG
1 [F] 100
CH: chr1:199733800-199734239 4E-119 [R] GAGCAAGCAAAGATCACAAGC [R] 100
CAM-20 ZF: Contig70.196:1579-2012 433 EST & gene [F] [HEX]TAACAGGCAGGAATGCAGG 0 [F] 100
CH: chr24:2939427-2939862 9E-105 [R] TCAGCCAGTGTTGGAGGTC [R] 100
CAM-21 ZF: Contig74.100:2226-2651 425 Gene [F] [6FAM]TGGGAGAACATTATAGCGTGAG 1 [F] 100
CH: chr2:2408229-2408652 1.1E-96 [R] TTGAAATG
    R
GAACCACGGAC
[R] 95 (1)
CAM-22 ZF: Contig75.34:11916-12343 427 None [F] [HEX]
    R
AG
    R
GCCACTTTCACTCCTG
3 [F] 90 (2)
CH: chr18:6214289-6214714 1.2E-76 [R] ATGCTGTGACACT
    K
GGAGGC
[R] 100
CAM-23 ZF: Contig83.70:49198-49633 435 EST & gene [F] [6FAM]CTCCACTTAGCTTGTAAATGCAC 1 [F] 96 (1)
CH: chr6:31243934-31244369 2E-142 [R] CCAAG
    R
AGTGCCCTAGATGTC
[R] 100
CAM-24 ZF: Contig122.74:8163-8588 425 None [F] [HEX]CCCACTTCAGTCTTCAGAGC 0 [F] 100
CH: chr1:2092872-2093301 1.8E-59 [R] TGGAGTATTTGGGATTGGAG [R] 100

*, the zebra finch sequences were isolated by a search of the unassembled contigs and super contigs of the zebra finch genome and the chicken sequences were isolated by a search of the assembled chicken genome (v2.1). The sequence of each locus is provided in Additional file 2.

bp, base pairs;

ZF, zebra finch Taeniopygia guttata;

CH, chicken Gallus gallus;

F, forward primer sequence;

R, reverse primer sequence

¥, The forward and reverse primer sequences match 100% to zebra finch and 86–100% to chicken Gallus gallus when the degenerate bases are accounted for. The degenerate bases used in the primer sequences shown in bold and underlined, R = A or G, Y = C or T, M = A or C, S = C or G, W = A or T, K = G or T;

Ψ, calculated by dividing the number of bases matching chicken (after accounting for the degenerate bases) by the total length of the primer sequence;

Ŧ, assessed for (a) similarity to sequences in the NCBI nucleotide EST and nr/nt databases identified using blastn (distant homologies) settings and (b) for similarity to protein coding regions in the CH & ZF assembled genomes which was identified by the presence of exons within 5 kb of the source sequence (searches performed 30/09/2011). Details of the sequence homologues found are provided in Additional file 6.

Dawson et al.

Dawson et al. BMC Genomics 2013 14:176   doi:10.1186/1471-2164-14-176

Open Data