Table 5

Primer used to verify microarray experiments in liver tissue by qRT-PCR

Gene name

Probe-set ID

Sequence 5' - 3'

T(°C)

Size (bp)


CCND2

Ssc.15749.1.S1_at

For AGGAGCAGATTGAGGTCGTG

86

185

Rev CAACCAGAGAGAAGGAAGGAGA

NCAPG

Ssc.28512.1.S1_at

For CTTGTAGATTTGACGAGACCA

60

156

Rev GGCTTTAGTATAGACCCGAAC

MGMT

Ssc.19639.1.A1_at

For GCAACTACTCGGGAGGAATG

88

171

Rev CTGCGAACGCTCAGTCTTG

GADD45B

Ssc.14764.1.A1_at

For GGACTTAGACTTTGGGACTTG

60

140

Rev GTAAGCCTCCCATCTCTCTT

SDHB

Ssc.8939.1.S1_at

For GCAGGACCCGTTCTCTCTGT

60

170

Rev GGTTACAGTCACGTTAGGTTGG

PPARGC1A

Ssc.16864.1.S1_at

For GTAAATCTGCGGGATGATGG

60

208

Rev TGGTGGAAGCAGGATCAAAG

PRKAA1

Ssc.8107.1.A1_at

For TTGTTAATTTCATAAACTTTGCTTC

60

193

Rev GTGCAGCCTTGACATACTC

PRKAA2

Ssc.16257.1.S1_at

For TCTGTAATTCTGTTTTGCCTACGA

60

168

Rev AGCAAGAAGGTGATGCCAAG

RPL10*

Ssc.9130.1.A1_at

For CTGTGTTCGTCTTTTCTTCC

60

199

Rev TCATCCACTTTTGCCTTCT


CCND2 - cyclin D2; NCAPG - non-SMC condensin I complex, subunit G; MGMT - O-6-methylguanine-DNA methyltransferase; GADD45B - growth arrest and DNA-damage-inducible, β ; SDHB - succinate dehydrogenase complex, subunit B, iron sulfur (Ip); PPARGC1A - Peroxisome proliferator activated receptor γ coactivator-1α; PRKAA1 - 5'-AMP-activated protein kinase, catalytic α1 chain; PRKAA2 - 5'-AMP-activated protein kinase, catalytic α2 chain; RPL10 - Ribosomal protein 10; * house keeping gene.

Oster et al. BMC Genomics 2012 13:93   doi:10.1186/1471-2164-13-93

Open Data