Table 3

GenBank accession numbers, PCR primers, amplicon sizes and PCR efficiencies of the RT-qPCR assays used in the current experiment
Gene Accession no. Forward primer Reverse primer Amplicon size(bp) PCR efficiency
CYP1A EX725014 CCTTGACCTCTCGGAGAAAGAC CGCCCCGCTAGCTATAGACA 146 1.85
CYP1B1 GmE090818c16636 CAGATGCCCCACATCACCTT GATCGCCTTGTCTCCGTTCA 108 2.10
CYP1C1 GmE100215i31189 GTCAACCAGTCGTCCGTGAA CGTTGTTCGTGAGGTCCTTGT 115 2.02
AhR2 EX728781 CAACCGGCGGTCCACAT GCACCATGCAGTTGCCAGTA 132 2.08
AHRR F2Z8C0H01CDEIU GAGGTGTTTGTCTCCCGTCTCT TTCACCAGGTCCACGCAGTA 77 2.06
GST pi EX730032 GTCCCCCTGCTGCCATTC CCTCCATACACCGCCACCTA 126 1.85
p53 EX723548 CGCTGCTGCTGAACTTCATG GGATGGCTCTCCGGTTCAT 63 1.86
RAD51 AACCTAGCATCCCGCTCAAA TGGTCAGGACAACTGGGATGT 91 1.89
IGF1 CTCTCCAAATCCGTCTCCTGTT AGATGCGGGCAATGTCACAT 101 1.99
IGFBP1 GTGAGTCCTCCCTGGATGGA CTCGACCCCAGGATCTTCTTC 79 2.02
Ferritin EX726260 GCGTCTAGCTGGACCCCTTA GGGCGACTACATCAGCAACC 101 2.08
Transferrin EX722617 ACGACGGGTCAACTCGTTTG AGTCACTCGGGCACAATGTG 139 1.83
HSP70 EX741726 CATGACATCGTCCTGGTTGGT CGTAGGCCACAGCTTCATCA 121 1.84
HPX (WAP65-2) GmE100215i27905 CGCCTGCTCTACATCGTCAA CGTAGCGTCCAGTGGTCCTT 129 1.89
MCM2 GmE100215i14387 TGGAGGACGACGTGAACATG TCGTTGTTGTCGCGTTTGAA 130 1.77
CDCA7 GmE100215i27789 GCATCTGCACCAACGTGAAG CCCCCACACACTCTGGGTTA 120 2.02
EF1A EX722124 CGGTATCCTCAAGCCCAACA GTCAGAGACTCGTGGTGCATCT 93 1.97
B-actin EX739174 CACAGCCGAGCGTGAGATT ACGAGCTAGAAGCGGTTTGC 95 1.93
Ubiquitin EX735613 GGCCGCAAAGATGCAGAT CTGGGCTCGACCTCAAGAGT 69 1.93
RPL4 EX725958 GGTGCCATACAGCTGATCCA CCAGGCATCACACTGCAGAA 123 1.83

Olsvik et al.

Olsvik et al. BMC Genomics 2012 13:702   doi:10.1186/1471-2164-13-702

Open Data