Table 3

Validation of microarray results by qPCR

Gene

Accession

Primers

Microarray fold change

qPCR fold change

p-value

Product size


CD14 moleculea

NM_213973.1

F:GCAGAGGCTTTGAGGACCTTATC

2.798496395

3.835

0.0001

154 bp

R:GCTGCGGATGCGTGAAGTT

CD3e molecule, epsilon (CD3-TCR complex)a

NM_214227.1

F:ACCTCTTAGTTCCTCCCTTTG

5.671628855

4.619

0.005

137 bp

R:TGCCAGCATTTACCCAGTC

heat shock protein 70.2b

NM_213766.1

F:AGGCGGAGAAGTACAAAGCG

3.374059696

5.775

0.007

257 bp

R:GATGGGGTTACACACCTGCTC

TIMP metallopeptidase inhibitor 1b

NM_213857.1

F:CGCCTCGTACCAGCGTTAT

8.614065715

11.357

0.008

127 bp

R:GTGGAAGTATCCGCAGACGC

superoxide dismutase 2, mitochondrial (SOD2)b

NM_214127.2

F:TCTGGACAAATCTGAGCCCT

2.647298815

2.1687

0.003

119 bp

R:GACGGATACAGCGGTCAACTT

S100A4

XM_001929560.1

F:GTCCACCTTCCACAAGTA

5.120172033

5.4957

0.006

152 bp

R:TGTCCAAGTTGCTCATCA

S100A6

NM_001044557.1

F:AAGGCTGATGGAAGACTT

3.082743701

5.5237

0.016

105 bp

R:TTGAGGGCTTCATTGTAGA

Caveolin 1

NM_214438.2

F:CTTCACCACCTTCACTGT

4.301157871

2.319

0.041

184 bp

R:GGAATAGACACGGCTGAT

Caveolin 2

NM_001123091.1

F:GCAGACAATATGGAAGAGTG

5.305246137

3.327

0.011

85 bp

R:CAGGCTGACAGAAGAGAA

coronin, actinbinding protein, 1A (CORO1A)

BT025463.1

F:GTGGACTGGAGCCGAGATGGA

6.065784814

5.7667

0.0001

200 bp

R:GCCACCTGCCGCTCACTC

protein phosphatase1, regulatory (inhibitor) subunit 13 like (PPP1R13L)

XM_002801296.1

F:CACCAGAGCAGCCGCAGAG

0.506516661

0.2116

0.0001

107 bp

R:GTCCAGGAGGAGCACCAGAGG


a: Primers from reference 87

b: Primers from reference 16

Wang et al. BMC Genomics 2012 13:68   doi:10.1186/1471-2164-13-68

Open Data