Table 3

List of the genes whose transcription profile was evaluated by qRT-PCR
Gene name Accession number Primer 5-3primer sequences
Oxalate oxidase Y14203 F CTGGCTGTTGAAGGACACAA
R TGACTCCGGAAACAAGCTCT
Callose synthase AY177665 F CATCAAGGAATCAGCTGCAA
R TCGCATGAACAAAGAGTTCG
Sucrose synthase X65871 F AAGCTGAAAGGCCATATCCGTT
R AGAATGCAGGCTGCACAAATG
Adenosine diphosphate glucose pyrophosphatase AJ291451 F TCATCAGCTCCTCCTCCAAC
R TGCCACCGTTGTACTGGTAG
Flavonoid 7-O-methyltransferase X77467 F CGAGGCTTTCCCTTATGTCA
R ACTCCATCATGTCACCAGCA
Leucine Aminopeptidase 2 AK248195 F TCGGGCTCACCAAGGCCAACG
R GAGGATGTCGCCCTTCCAGTCG
Rubisco activase M55447 F TCCAAAAACTTCATGACCCTGC
R CGAACACAAGCTCACACTGGAA
ATP synthase B chain EU963772 F AGAAGGCCGCACTGTTTGACT
R CATCCATGAACTTGCCTAGCG
Chitinase X78672 F GCCACGTCTCCACCCTACTA
R ACCGTTCTGAAGGACACCAC
Chitinase III AK251032 F TAAGCTGTGCCGACTGAATG
R CACTGCAAACCACAACATCC
Actin AJ234400 F ACCTCGCTGGGCGTGACCTAACTG
R TGGTCTATGGATTCCAGCAGCTTCC

For each gene the accession number and primer sequences are provided.

Bernardo et al.

Bernardo et al. BMC Genomics 2012 13:642   doi:10.1186/1471-2164-13-642

Open Data