Table 4

List of primers used in chromatin immunoprecipitation assay
PCR amplicon Forward primer Reverse primer
Cacna1g - 1 TCAACCTTGCCAGCAAGTCAAAGC ACAGGCAAGAGGGCTACATGAACT
Cacna1g - 2 AAAGATGTCAGAGGCCGGTTGG TCCAGACCGAACCCACTTTCCTAT
Cacna1g - 3 AAGCGAAGAAGCCGGAACAAAGTG GCTCTAGAGAGCTTGCTGAGTCCC
Cacna1g - 4 GTGCGAAAGTGCGTGGTAAACTGT AGGCTCCGTGAGTTTGCTGTGAAT
Cacna2d2 - 1 ACCATGCCTTAGCCATATGCCAGT TCTCCTCAAAGCCGAGGACAGAAA
Cacna2d2 - 2 GGGTTAGTGGGTTGTGGTATTGTC TTCGAGGAGCTGGGAAGCTAAGAA
Cacna2d2 - 3 TATCTCTGCAGCCAGAATGTGCTC AGGCTTTGTTTCTCACTGCCAACG
Kcna6 - 1 AAGGTAACTCGGTGGTTCCCACTT AATGGCAATGTTATGGGAGGGAGG
Kcna6 - 2 TGTCACCCTCATCACTATCCCTGT AGCTGGGATATGTAGTCTGTTCCC
Kcnh8 - 1 TTACCTGCAGTGACCTGTCTCCT AAACGCGAGTCAGAGCAACTCC
Kcnh8 - 2 CTAAATGTATTCACTGTTCAAAGC GTCAGCAAATTCTAAGCATCA
Drd3 - 1 GGCAATTAAACTGAGGATGGTGAG TCCCTCTGAGGCTCTATCTGCTTT
Drd3 - 2 GCAACAGCAAAGTGGAACTCAG GTAGCATCAGTCAGTAAGCAAAGGG
Gabra3 - 1 ATTTGGAGCCTGGGTTAGAAGGCA TACCAAGCCGCTGTGAGATGCTTA
Gabra3 - 2 TAAGCATCTCACAGCGGCTTGGTA TCTAGAGAAGCTCAGAGAGAAGGG
Glra1 - 1 ACCTTGAAACCAAAGGGAGCATGG GGGCAAGGAACTGTTGGG
Grid2 - 1 TTTGAGTCCTGCCTTTCTCAGTCC TAAGAGAAGCGAGTCCGCAAGAGA
Grid2 - 2 TCCTTGCCCTGGTGAAAGAAAGGT CCTACAGCATGCAGATCGTTAGGA
Grid2 - 3 AGGCTATTCAGAAGTCGCGCTGAT TGTGCAGTTGACTGGAAATGCCAC
Calb2 - 1 AGACCTAATATGCTTCAGGCTCAG AGGTGGGATAGAGGGACTGAAAGA
Calb2 - 2 TTCATCCTCCTTTCTGGGAGGCAA TCCTCAGAGCACCTGCTGTCATTT
Calb2 - 3 TGCTCTACATGGTCTTCACAATGA GGTCTGGTAGCCACCTCCAA
Gapdh – P CCGACCTTCACCATCTTGTCT CTGGCCACGCTAATCTGA
Gapdh - E TTGTGACAAAGTGGACATTG AACTTGCCGTGGGTAGAGTC

The positions of the primers are shown in Figure 4.

Wisniewska et al.

Wisniewska et al. BMC Genomics 2012 13:635   doi:10.1186/1471-2164-13-635

Open Data